Description :
From Genome Similarity Track
Location :
Scaffold_24:38428- 45562
Transcript NameFunction/comments
Physo_294392predicted protein
Physo_568385Hypothetical protein

Sequence
7134 bases(100 bases per row)
TTCATCCGGCGCGTGTACTTTGTTTTGGTAGCAGCCTTCGGTTTGGACGTAGCAACAACGGCACTGTTGCTGGTCCGAGGTACTTTAGCCGACCGACACT
CCGTGGTCAATACCTTATGCTGCCTCGCCCTCTTTTTTGTGGGAGCTGGAAAAGGGTCATCAGGTTGCAACATAACCAACATTATTAACAAAAAGAAGCA
ACATTGACAACAACATAGCCAACATATCAGTGACTTACATGAGCTACTGGTAGTGCCCGCATTGCAGTCCTGCTGCTCGTCGTCGTCATGCCCGCCGGTA
TGGAGCACTACGTTCAGGGCAGGTACACAGCCAAACTGTGAGCAAACTCCGGCCTCACCATCCCGCCCACCCTCGAAGGCTGGCATATTGCCGACCGGCA
CGTCGTCCTTGGCAGGCGCCGCGTCGTCCAGCAGGTCATCTTTGGCGATCGCCGAATCGTCGAGCATCACGTCCTGGCCGGGCCCCGAGTCGTCCTGCAC
CACGTCCTGGCCGGGCGCCTTGTCGGCCAGCACATCGTCCTTGTCGGGCGCCGAGTCGCCCGGCATCGTGCCTTTGCTGGGCGCCTTGTCCTCCGGCGCA
TTGGCCTGGTTGAGCTCCGGGGCGTCCGACGCCGCGTCCTTCCCCAGCCCCTCCGCTTCTAGCGCGTCGTGCTGGTCGAGCGCCGTGTCATCTGGCACCT
CAACCTGGTGCACAATGCCGCTCGGCGTAGCGGCCTGTACGGGTAGCACTTTATTCGGCATAACGCTCGAGTTGACGTTGCTCCTCGTGCTCTGGTTGGG
TCCGTCGGTGCCCAGCAAGATGTCCGAGTCGTCCAGGTTGTCCACGAGGTCGGGGCCGTCGTCCCGGTCGTCGACGCCATCGTCCGGGTCGTCTTCAGGA
CGATAATCATCATCACTGGCGTGGTCCTGGACAAAACCCAGCACTGCACGGAGGTAGTCAACGGGTTTTCGCGCTCGTAGAGAAGCACGTCGTCCTATTG
TACAGGAAGTAGCAGCGGGTATGTGAAATAAAAGCAGTTAGTGCCCATTAGAGCCACCTTGTTCAAACCATATCGTTTTTGCTTACCCTACGCTGGTCTT
CTTCACGGCGCTGTTCGCTCACTCGAGCACCTTACCGACTCCCTTGATCCGCTTGTCTAAGCAGTAGCAACGTTGAGACGTATTAGATCAATTTGTGACA
GTATTCACAGCATTATTTGCACTTACCCTTCACAGCGGACACTGGCTTCTTCGCCTTCGTCATTTTTTTCGCCTTCGCGGGCGATTTCTTCACCCCTTTC
GCACCCGTGGGTTGCTTCGTGGCCTCTTCGGCCGGCATCCGGAGATTCGTACTTTAATGGTATGGAAATATCTTGGTGAAATTTCAACTTCAATTTGAAC
TTCTTCGAAAATTAAATTGGGCATAAATTACCGAGCAACACAACGCTGTACTGTGTTGCTCTCATTAAGATATCGTGATGTTGTAGCAATGTTGTAGTAA
CGACTTCCAAACAAGCTTCTGTTGTCCCGAATACAGTTGAGTCGAAGATGTCCACCTCACGTGGACTTTATCGTCCTGTGGTTCACACCAATAGATGTGG
TTCACACGACGCCTCGCCATTTTCGACGCGACTGCGAAATACTCGTATCATGGCGACGCACTACGGGCGGCACCTGGAGCGGCTGCAGCGCGGCGAGCAC
CTGGAGGGCAACGCCGTGCTGGCGCTGTGCGAGCGCGTGAAGGACCTTCTGGTGGAGGACGACAACGTGGTGCGCGTGGCGTCGCCCGTGGCCGTGTGCG
GCGACATCCACGGGCAGTTCCACGACCTGCTGGAGCTCTTCAAGCTGGCGGGCCAAGCGCCCGACACGAGCTACGTCTTCCTCGGGGACTTCGTGGACCG
CGGCGCCATGAGCGTGGAGACCATCTCGCTGCTCTGCGTGCTCAAGGCCAGCTACCCGGAGCGCGTGACGCTGCTGCGCGGCAACCACGAGTCGCGCCAG
ACGACGCAGGTCTACGGCTTCCAGATCGAGTGCATGAAGAAGTACGACGGCGACGCGCGCATCTACAAGGCCTTCATGGAGCTCTTCGACTTCCTGCCGC
TGGGCGCGCTCATCGACGACCGCCTGCTGTGTCTGCACGGCGGACTCAGCCCGGCGCTGCATCATCTGGACCAGCTGCGCATGCTCGACCGGTTCCAGGA
GATCCCGCCCGACGGCATCTTCGCCGACATTGTGTGGTCCGACCCGGACTCCAAGACGCTCGGCTTCCACATGGTGAGGGCGGAAAGGAGAGGAGAGTGA
AAGGAGAAGAGTGTACTGATCGGTTGATTCGTGGTTTGCTTGTGGTTTGCTTGCAGTCGCCGAGAGGAGCGGGCTACATCTTCGGAGAGGACGTGGTGGA
GAAGTTCCTGCACACGAACAAGCTTTCGCACATGGCCCGAGCGCACCAGTTGTGCATGGAAGGCTACCAGGTGCTCTTCCGAGAAACCTTTTCGACAGTC
TGGAGCGCGCCCAACTACTGCCACCGCTTCGGCAACTTGGCCGCGGTCATGGCGGTTAATGATAACCTTGAGGTGGGTGGAGGTTGTCTTGTGTTTTTGA
GTTGCAAGCGATGACGAGTTGCTTACTGGTTGCATGGTTGTCTTTCATAGCGCACATACAAGACGTTCAAGGAGGCTCCGTCGTCGAGGAACATTGGCGT
GTTGGACAGCAAGGGCACGAGCTCGGACGCCATCGACGCCGGCTACTTTACCTAACATGCGTTCAAGTATAACGATGATACACGCGATAAGAACTACTAC
TACGAGACAAGGAGGGTCGATAGATTTTGTACGCTGGAATGGAGTAATGCACGTTGACGTGGACAACTTAACTTCCCTTAGTGATGCCGGCGCTTCTTGT
CCTTGCGCTGCTTGGAGCGGCGCTTGTGGTCCTTCTTGGCCTTCTCGTACGCCGCTGCGATCTGCTCCATCGTCTTCAAGTGCAGCGGCTTCATCTTCGT
CTTGACGCACTTGTCGATCTCCAGAGCGTCGTATACCACCAGCGACTCGTGATGGTTGTAGAGCTGCGCGTTGCTGATCATGAGGTTGAAATCGGCTTCA
AACTGTTCGTGCGACGCGTAGTAGTATTTGTCGAGGCGCGTCTTGATGGTCATCAAGTCCATCGGAGTCTTCACGATGCCGTAGTAGTCAGGGTAGTCCA
CTGGCGACGGCTTCTCCACGTACAACTCGGAGCGTAGACGTCCTGTGGGATCTTTGAGTTTGGTAACGGCCTCGTAGACCTTGCGGTAGTAGTAGCACAA
CATCTTGCGTTCGCGCCGACCCGCGTCGTCTTCATTGGGGTTGTCTTCGTCTTCAACTTCATCAGCGGCAGCAGTATCCACGAACTCTTCGTCCTCGTCG
CGCTTCCGTTTGCCTTGCTTGGAGCTCTTGGGACTCTTCGCCGCAGCCTTCATCTCGTCCTCATCGATTCCATCCTCGCACATCTTAACGAACTCAGCAT
CGGTAAACTGATCGCGGTACGACATCTCCTTGCGCTTGCGCGGTTTGCCTGCAACGGTTTCCATGTCAAAGTTCCAGCTGTCCTTGTCGTGCTTTCCGGT
GGCAATGTCGTGCTCCATAACTTCGTTGGCTTCGCGCAGCCAAGCCGGGGCATCCTTCTCTGACATCAGGCGAGAACGGGGAGTGTGCGGGACATGGTAT
TGCTTGCAGTACTCCTCCCACTCCTTCGCCTCACGAGCCTTACGCTCACCATCCAGACGCTGGTACAAAGCGAGCTCTTCATCGGTCAGCGCCATCATCT
CATTAATCTCGTCATCCAACAGAACGTTCGATGCGTCATCATCGCCGTGAGCTGCGTGTGCTGCCTCCTCCTGCTCCATCTTGATGAGACTCTCGAGCAT
CGCACGTCGTTCTGCCTCCTTGGAGCGGTTGTTGAACTTACCAGCCTCCACAACGAGATTGTTCATATTCATCTTGTCGGTCGCACGCGACAGAATCTTC
TCCTCCACAGGACTGTTGGTGACAAGTCTGAAGACGCGCACTTCATTCTTCTGACCGATACGATGCGCGCGATCCTGGGCCTGTGCATCCATGGCAGGGT
TCCAGTCACTGTCGAAGATAATGACCGTGTCAGCTGTCGCGAGATTGAGTCCGAGACCACCAGCACGAGTACTGAGAAGGAAGATGAAGAACGGTGAGTC
CGGCGCGTTAAACATGAACATTCGCTGTTCACGTTCATCAGCACTTGTGGAACCATCCAGACGGAGGTAGCGGAAGCCACGATAGTTGAAGTAGTCCTCC
AGCACGTGCATCAATTGCGTCATCTGACTGAACATCAGCACGCGATGACCTGCAGCTTTCAGCTTCGGCAGCATGCGATCCAGCAACTCGAACTTGCCCG
ATGACCGAACGATGTCGAAGTCGATCTGGTAATCATTTGTCTGGAACAGGTAAGGGTGGTTGCACACCTTGCGCAGCTGCATCAACACGTTGGAAAGACC
CTTGGACGTGTACTTGGTCTTTCCCTTCTTCTTACCCGAGCCGTCTGTCGTCTCCATCAGCAGCGCGCCACCTTCTTGGATGCGTCGGTACATGATCTTC
TGCCAGCCAGAGAGTTCACACTTCAGCACCTTCTCCACCTTGTCCGGAAGCTGGTCGAGCACAGACGCCTTGACACGACGCAGCAGGAACGGACGCAGAA
CCTGGTGCAGTCGGTTAATGATAAGCATTCGCTCTTCGTCGGACAGCTCGTTCGAGTCACCATTCCCAGAGAACTGAGCGAAAGGCTTGCTAAACCATTG
CTCGAACGTGTCAACAGACTCGAAAATTGTCGGCAGCAAGAAGTTTAGCAGAGCCCACAGTTCCGGCAGACTATTCTGCAGCGGAGTACCTGTCAGCAAC
AGTCGGTTGCGCGACGTATACATGCTTCCAAGGGTCATTGCGAACTTGCTCTGTGCATTCTTCATACGATGACCCTCGTCGACGATAATGTACTGCCAGT
CGTACTTGCGGAGCACATGCTTGTCCTTCATGATGTACTCGTAGGTCGTCAGAAGCACATTGAACTGGCACGACGCCATTTCCTGCCTGTGCAGTTCCTT
ACGCACTTGCGGTGGGCCCTTGTACACCACGAGCACGAGATCAGGAGCCCACTTCTTGAACTCGTTCACCCAATTCGACAATGTGGAAAGAGGCACGACC
ACCAGGAAAGGGCCGTGGTTGTGCTTAACCTCCGTCACATACGTGAGCAGTGAGATAGACTGGATCGTCTTACCCAGACCCATTTCGTCGGCCAGAATAC
CATTCAGGTGGTTATCGTACAGGGACACCATCCACTGCAAACCGCGCAGCTGGTACTCCTTCAGATCTCCACCAACGAGCATAAGAGGCTGACGAGGCAG
CTCTCCCTTCGACGCAATCTCCAAGTAGTTTAGGTCGTCATCCTGGTCATCCTCGGCGTTCGTGTCCTTGCCACCGTCGTGGTGCGCGTCGTAGTGCGCC
GTGTACTCGTCCACCACGTGGTGCTTCCGCTTGTGCTGACGCACCAATTGGCGAATGCTGTCCAAATAGCTGTTTGTCTGACTCAGCAGATACGTCAGAC
GCTCGTTCTTGGCTTCGGCCACCAGCTTGCCGTACGCCTCCATATCGTTCGCCTTCAGAGCCTTGAGACGAAGCTTCTCTTGACGATCTTCCTCACGCTC
GGCCTTGGAGTTCTTCTGGTCGATGAAGCCCTTGACCGCCTTCGCAGACTTGCTCGCCTGCGCCTTGACGTTCTTGTGGTACGCGAAGAACTCGCGCGAG
TGGTTGAGCACGGCCTTGAGGTACATTTGGTGGTCTGCGCGGCGCTTCTTCTCCATGGCCACGGACTTCTTGCGCTTCTCGCGCTCGTCGCCCTGCAGCT
CCACGCGCGAGACCGGACGCCGACGTCGGAAGGACTTGCGGTCGACCGCAGACGGCTCTCCAAGCAGCGCCAAGCGCGTCGTGTGCGCCTTGGCCACGTG
TCGCTGCAGCTTCTGTTGCAGCAGCACACAGCGCAGGTCTCTGAGCGTGCGCAGCTCGTTCTCGTCCAGATCTTCTGTGTGGCTCTCCAGCTTCTCCAGA
CTGGACGTCAGGAACTGCTGCAGCGTGTGCATGTACCGCATCTTGAGCGCGACGTCATTGGCGCCGAGCCACGGGGTGCAGACGTTGAACGGCCCGAAGG
CCGAGTTGCCCTTGTTCTCGATGCCGATGAGGTCTCCGTCCAGGTAGTTGGGTCCAATGTACAGCAAGTTGCGCGACGCGCGCGTCCACTTGGGGGTCAG
CAGCTCCAGCACAGGAGGGTCCACGGCCTGCGTCTGCTGCGGGAGCGCGCCCGTTGCGCCCGCCATCATATTGGCCGACGGGCCCGTGGGCTGCATGGTG
AGCCCCGCGGCGGTGAGCTGCTTGGCCTGCGCGATGGCCGTGTCCATGGAGTGGCACAGCGCCTTGTAGGCGCGGATCTGGTTGTGCAGATACTCGAGCT
GCTTGTCCGAGAAGAGCGTCGTCTTCTGCTGCATGAACGGGTTGGCCGCCACGTCCAGAGGCTGCATGGGGGCCTGTGTCTGCTGCTGCTGCTGCTGCTG
CATCTGGACCTGGCGCTGCCGGTGCTGCTGCTGGTACTGCCGCAGCAGGGCCACGATCTGCTGGTACTTGGGGTGGTTCTTCTGGCCCGCGCGCTGCATG
CGCAGGGCCGCGTCCATGAGCTTCTTCACGTCGGTGGGCGTCAGCGACATGCGCGGCGCCTCGGCCGCAGGCGCAGGCACGGACGCGCCTCCCGCGGACT
CCATTATGGGCGAAGGATTACAGCAGGAGAGGAGGCACGCGCTTTTCGATTGAGGTTGGTGGCGGAACAGCGGTTCACTTGGTTTCAGTATAGGAGTGGT
GTGTGGTGTGGTACACATTGTTTTGTGTACGAAACGTAAGGTGGTTGAAGGGGGGGGGGGAAACATAGGGAAACATGGTGCTGCTACTTCAATCATCATC
ATGCTGTCTGTCTAACAACTGCCTGCTCTGTCATCTCCCGGCCGAGGTGCCGCCGCGTAGCTGGAGAAGCTACGCAGACCACCGTCATAATCTAAGAGAA
CGACGCGCGGTCGAACACGTGGAGTGGGAGCGAC