Description :
From Genome Similarity Track
Location :
Scaffold_6:38424- 41982
Transcript NameFunction/comments
Phypa_INRA-310PPTG_03742hypothetical protein
Phypa_INRA-310PPTG_03743hypothetical protein

Sequence
3558 bases(100 bases per row)
TTAACCCTTTCGCAGTGCGAGGGCGCATTTTTCGCCTTTAAACACCTTTTACAAAACAAGGTGGGAAATCGTACTCTAAAAGGGCGTTTTTTTTTGCCCT
TTTAGCTTTTTCTTCAGCTCTGCATACCGTGTTTTGTTATTACCAATCACAGCACTGAATGCAGTTAGGATAGGGGTAATTTTTGATCCGCCTCGTATTT
TATTGCTCCAACGAGCGTAAGCGGCCCTATGTAAGTGGTCGTACCATCAAGGAAGCTGCCTATTACACGACAGCCAGTCACCAGACCATACAAACGGTAA
GACAAATGCATACCTCCAACCTTCCATTTTGCTTTAGTGTACTCAAGACTAATGCACACAAGTTTCACAGACGCAGAAGACAAGCTGCTGGTGCAGATTG
CGTTCCAGTTCGAGAAGGAGGGCTTACGCGTCACATGGGACTACGTAGCCCGCCAAATGAAGACCAAGCGGTCCGCCCGCCAGCTGCGGCTTCGGTTAGC
CAGCCTAAAAAGGACGTACGGGAAGGCAATTAGTGGTTTCCCGCCATGTTTTCTTCGCGGCATGTCTTCAAGACGTCTTCTCGGAGCACCACCACAACCA
CCACCACTCGTATTGCAACGACCGGTACGACCAGCCTGCCGACCTCCAGCTACTCCGTCGAGTGCTAAAGGTCCCTACGGTGATCACCACGCGCCAGGTT
CGTCTTCTTTAAGGAGACGTTATTTTGTGCCGTTTGTGAGACTGACGTTGCGCTTGTTGGGTAGGTGATGACATATCTGCGAGTGCCACGAGTGGCAAAG
AGGTGCCGGATAGCAAGGAGAAAGAAATCCAAGGTCGCTGTGATCAGGGTGGAGGTGGCTGTATTGTGCGAACTTGTGGTCATCCACTGGTGGCTATAGC
GAAAAGCGTTTCTGGTGAGCTTCAAATTCTCTGTGATATATTTACGTTTACAATACTAACTAAGGTATTTGTGGCACAGGAACTGACTTCAGATCTTGTG
GAGATAATGTCCAAGCTGCTGAAGCTGTTGATATCATTTTTGGAAGTATCAGTGCTCATGACGTCCGCCAACCCGCTGGCCGCACTTATGACAATGCGGG
TGAGGTGGTACCGTCTGGTGTTACTCTCCTACTTGCAGCCGTTGGCCTAATCGATGAAGCGGACGTATTTCTCGACGTTGGGGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGT