Description :
From Genome Similarity Track
Location :
Scaffold_180:3842- 7230
Transcript NameFunction/comments
Phypl_g4795hypothetical protein
Phypl_g4796pantothenate kinase, putative

Sequence
3388 bases(100 bases per row)
AGCTTCAAGCATATCGAGAACGTGTAATGGATTTGATGGGGAGCAAATCACAGTGAGCTCGGAGATATCTATTTGTCACGCGTCACGAATACAATGAAAA
GCAGCACAAATGAGGCAACATGTTCTTCGTCTTGTACGCATTGCGAGGGCGGCTTTCAGGATCGCGGCCTAGTTGAGTCATCAGTAAGTAAAACAAAATC
GTCTGTTGAGCTTCTTTGATGGACCATTCAACTTCAAGGCAACGTGGTAAGTGCCCCAGTGTATTGAATACGTGTTGTTAGCACCAAATGCGATGCAGCA
CAACGAGCTGGCGATGTCGTTTACAGCTTACCCCGAGCAAgttccttcttctcgtcgcgTAACAAAGCCTGGATATTATCCGATGTTTTGCCCATAGCCT
CGGGCAAGCAGTAGACGAAGAACGGAACGTACAGCAGGGTCACGAACATGAAAGACACGAATGAGTAGTTTTCAAGACCGTCGTTCATGTACTGACAGAA
CCAGTTGATAGCGACGCAAATGGATCCACCCGTGGGGTCAATGCCCGTGATCTGCTGAGCGCAAGCAACACCAATGgcgaccaccaccagctAACGGTAC
TTGCGCGACGTGATCTAGCCCCACATGGTAAGAGTCTCCTCTTGCTCCTCAGGCTCCGTCGAAGCGCTGCCATCCAAATTGCTAGCAGACTTATCGAGCC
ATGTCAAAGCGTGTTGCACACGTCGGGGCCGTAGAAGCGTGGAATTTTCTTGGCCGCACCTGCACGCCAGCCTTGGCCAAGAAGCCACACAGGGCTTTTC
CAGCATGAAGAACGGTGCCAGAATCAGGATAAAGGATCGAGTTGGTGACGGGGAAGCCAGTCAGCATGCGCCATCCTGCAAATGTGTCTGcgaaaaagaa
gaagactACCACCACGAGCAGACCGAAGGTGAAGCAGATTTGGAGACCCAAGTGAAGCACCgactgaagctgctgcggcgaaATTTCGGAGTTGTAGCTG
CCGACAAGACCCGTCGGAACACCAGACGACCAACAATGAACTGCGCAATGTCGAAAGACGCCGTCTGGCGATGAACATGACGATAGCGTTGATCGTATCA
TGgtcgtcagcttctgcagcttgatgtCGGTGCCCGTCTCCTCCAACCAGTTGCATTGCCACAACTCGCCCGGACGCACGCACTGGTACGAGCACGTCTG
GTAGTTGACGCGGCCAGCCATGGGGCGCCGTGGATGACGTACATCACGCGGTcgaacgagaagaaccagAGTTCGTAGCGCCACTTCTCCGGCTTGccgt
ccaccgactcggcgTCGTAGTCGTAGATCAGATGCAGGTCACGGATATCCTTGTCGAAGGTCGCGTCTAGCGGCGTGTTGGTGTGGAAGCCAGGGACGGT
GAGCGGCATGGTGACTGGGTCACTGGGTCGAGTCGCTTGGTCACTTGACAGGAACTTGCAGAATGTTGAGCTCTTGCAttgcgacgccgacgcgatACCG
GGAGCGACTGCCACCTGGATCAAAGGAAAAAGGTTCCTGTGTCCTGGGTGCTTGGAGAATCGACCGTCAAGGTCATACAGTATGTGTTGCAACAATCAGC
ACTCCGCTCATCTCGAGTGTGCGGGTCGCAGGCTTGCGATCCAGAGTGTATTGTTGAAGGGGTTTAGTGTCATTGCCGGCAATGCCGCCTGACACCGGGA
CCCCCCACCATGATCACCAGCGGTGTTACGATAAGTACTCATCTTGTGGTTCAGAATACTATCCAATTTGTGAGCCCTTCTTTTAAAAACTGCAAGACCT
TCACTGCTCATGATCAATCAGAAACACTTCTATTGAAAGAAGCCGTCGCTTTACGCAACGTCTTGCATCTTATAACATCGCTCTGAGTCTGTAATACGTA
GTACGACTTAGCGCGAACCTCGTGTCGCTGAGATAAACTCTTCGCCGTGGGCGTTCGTGGCCTCGGCATGGCGCAAGAATGCGCCCAATGCACCGAGATA
CCCTTCGTGCATGCAAAAACGCGCCTCCATCGCTCCGTTCGACCAGAAATTAATTGCGTACGCCAGCGTTCGAGATGAAATCTTGTTGTGGCGGAGAAAG
TTTCCGACGAAGAAAATGTTCTTGGTCTTGTACAAGGTCGCGTTCAGAAAGGCAACCTGACCAATATTCTGCGTGATCATGACCAGCAGTGATCGAGCAA
GATCGGCGTCGCTCACACTTTCACGAGACACCGAGATCATTTTGCCGAAACTGCTGGCAACAGTCGAAGCCGGAAGTTTGAACTTGTCGTACGCTCCGCC
GTAGATGTCTCCTACACTCATATCGACCGATTTGTTGGAGCCATGGACGCACAAATCCAACGCCTCGTCGTATGTGTCACAGTTGGTCATCAGACGGCAA
AGCCCCCAATAGGTGCCTCCGCCAATACTACTACCGCTCACACGTTCATAATCACCAGGCCCCTTCACGTACAGCACGCTCACACCCGAGCCAATACTGA
CAAGCTATGGCACGACGCAGCAACAGTGAACCCTAGTTAGATCAGTTTGCAGTCAATCGGCCAGTGAAATCTGATCATGCCAAAGACGCACCAGATACGG
GTAAACATCGTCGTCTGTATCGGTTTGGATGGTTTTCAcccgcgacgccgccagcgagTTGAAATCCACAACCTGCGTTGCAACCAGTCCAACCCTTCAG
CCTCATCTCCCCCCAGCCAGCACACAACAACCAAACTGCATACCTCAAAGGTGTACATTTCGTCGGACAGAGTCGTGAGCAGCAAGTGCAGTCCCAGAAT
GGTGcagtcgatctcgtcgtacttctccagctcAATCCCCGCGATCTCATTGAACGCAGGTCCGtactgcgagcagcaccagcacgacacAACTGTCACC
CACTGCGCAAACTCGGCAGAGTGAACACCGCACACACCTTGTGAGCTCCGCCCCCCGTGCAGGGCAAGATCCGGAGCGACTGGTTGATCCCGTTGCTGGC
AATAAACTCAATGGCCTcgcgcgtcttgctgctctcgAACCGCACAAAGTGGAAATCCtggcagcaacagcctcgtcagccagcacagcagcgcaaccTC
CGCCCGCCATCAGGCCACGCACCCCGTTGAGCGCCTTGGAGTGGATCCGCAGCCGCACGTCCTGCACGCCCGTGCGGCCGAACGActcgtgctcgcgcag
gAACTCGTTCATCTCGCcggccgccacgtccagcgacgccgagcgcgGCCGCTTGCGCGTGTCACCGCCGGCCTCGCGGCGCTCGAAGTACACGATCTTG
GCTAAGGTGccccctgcagcagcgacgacaacgtcaGTTCCAGCGCCCGAATCAGAAGCTCGCAGGTGTGTTTTTTGTTTTATTCAGC