Description :
From Genome Similarity Track
Location :
Scaffold_70:38414- 40864
Transcript NameFunction/comments
Phyci_231962Hypothetical protein
Phyci_521355Hypothetical protein

Sequence
2450 bases(100 bases per row)
AGAGCTCCATCATCTCGATGCTGGAGCAGTATGGGCTGGCCGTGCCGGAATCACCTCTGGAGAGTCTTCTGTGCAGTGAGGTAGCGCAGGAGCTCGATTT
GACGAGCCACCTAGTGGACGAGTGCCATGCTGTGGTGAACGATATTTGCTTCAACGTTGCGAATGCCATGCAACGTTCGATCCAGCTAAAGAATTCGCTC
GTGTCTGAAATGGATATCATTGAAGTCCTCGAAGTCGCCGAAAGCGTGCGGCAAGAGTATCACGACTCGACGTGGGGATATCTGAAGATTGCCTCTGCGC
TGCTGATCTTTCTGAGCGCGTCAGAACACGATGCCTTCACGCCTCAGACAAAGGGTCGACTTGCGGCCTCGCCTGGCCTTAGTCGTCTCGTGAAAGTATT
TTACCCGTATCTGGTTAACCATCCTCGGGAAGAACTCAGCGATAACTGGAACCCTGTCAGCAGCATCCTGGCTGCTATGAGACTGCCGGTCAACCAAATC
CACTTATTGCTTGACCCAATGTGCAAGATGCTACTTCTGGCGGTGCAATTGTGCAGCCGCTCTAATCAGGACTCGCAGGATGACGACGATTTCGCCGTCT
TCCCCAAAGTCACTGTCATTTGTGATCGTGAAGACGTACTAAATTCCAGTGTAGAATACGTTTGGCAACATCATCTATCGTCTGAGAAGGTCACCCCGAA
CTTCCTCCTATTCCCATTCTTCAAGAGCTCATTCGGCGAGAAACTTGTGGATGGAGTAAAGGTAGAAGAAGGAGAAGGGAAGGGCCCTCTGAAGGAGTGG
TTTGTACTGGTGGGCAAGCAATTGGCATCAAAATGGAAGCAAGTACCAATCAGCAAGCTTTTGGTGGAGGCAAGCTCACCCCAGATAACTGCGAGTGGGA
ACGCGGTGACAATCCCCGGAGCTGCCGAGGTTGTTTGCCCAGGTTTTCAGCTCGAATGGGAGACCGACGAAGGAGAAACGATCCGTCGAGTTGTAAATAA
GGCTTTGGAAGACGACATTTTCCTATTGGACCGAGGGATACCAACGCATTCGCTAACGCCATCTCAAGCATCTCAATTGCGTATTTCCAAACCAAATGCC
GCCATACTCGAATATGTGCAAGGATCCGAAAGCTATTGGCTCAACGAAAACACGGTTCATTCTCGCGAGACGCGCAACGTGTTGATTTTTGTTGGGTGGT
TCTTCGCCAGTGCCATGACGCACTTCAGCTCGATCCAGTTGAGAATTCACCCGCTCTTCTTCCGCTTGTTGCTGAACCCCCAGCACTGTGTGTCGCTGAA
AGAAATTGAGCTGTTCGACCCACAGCTGTTCAAGTCCTTGTCGGGGATGAAAGACATGAAGCCGTCCGATTTCGCGGAGTATCTGAAGTTCGAAGGTGCC
GACGAGAACCTTAGCGTCGAGGTGTACATTGCCAAAGTACTTGAGGACAAGTTCGGTCCGACATCTGGGATCGGGTGGCAGATCGACTGTGCTCGACGCG
GATTCACTCGGGTGGTTACCATCGAACAGCTCAGACGTGTTGGGATCGCTGAAGGAGACTTGGTAGAAAGCATTTGCGGCAGCGTTGGTGGAGGTGGTGA
TGACTTTGCCGTCAACGAAGTGTTTCGAGTGGCTGCAGACTCGGACTTCACTTGCTGCCAACCCCTCATGGACGCGTTCTGGCAAACGGTGAACAGCTTT
GAGCCGCCGTTGAAGCGGAAGTTCATCAAGTTTGTGACTGGTGTGGATACGCTTCCCCTGGCAGGAACGGAGGTATCTGTTAGGCGTGTTGCAGTTCGGT
ACTGATGTTATGATCGACTAAGTGCTCTTGTGTTTCGTGTAAACGTGAAGTTTTTGCGGATCGAACTGCCGTTCACCGCGATCTCCGCGGCTGACCACGA
GAAATGTCTTCGGATGCTGCCGCAGGCTCATGTACGTGTCTTTTAGCAGTATTTGAACGACTTCGCTAACACTCTACTTTTTACGCCAGACTTGCGACAA
CACATTAGAGCTTCCGCACTACTGGAGTGCACTGTGCTGGAGAGAGCAGCACAACGAGCACGAAGCCAATAGCAAACTGGAGGAAGAGCTCGCGCTTTTA
CTCGGCAAGAAGCTGCGAGATGCAGTGGAATACTCCAGTGGATACGGTCTGGACGGCACCTCGGCGGTTGGGAACGTATTCGCTGACAAAACGAGCACTG
GCGATGACAACGAGTTGGCCCAGGAGGAGAGCTACGACTCGTTGGGGCTCCCCGCGTTGTCCGAAGGTCAGGGCGAAGCGGACCTGCCCGCCGAAAGCTC
ACAGCAATCGCCACGTGGATCAGATCACGACGTGACCGGGGAAGAAGACGAAGAAGCTCCAGCGGAGCTCGACACTCACAAGCCACTCGCTGCAGCCAGA
TCGCCTGGGCCAGACGAGTCCTACGACGAGTATGACTGGGAGGAGGAGGA