Description :
From Genome Similarity Track
Location :
scaffold_26:384123- 385535
Transcript NameFunction/comments
Plaha_PHALS_04967centrosomeassociated protein

Sequence
1412 bases(100 bases per row)
TTATCAAGCGGCCGTCTCTGTCCACCTGAAAGATCGGTACGAGCGCACTGCAACTCTATTTCCAGATCTTCGTATTTGCTCCGTATTGCAAGCTTTTCGG
CTTCCAAGTCTCCATTTAGCTTTAAGAGCTGTGAGTTGCGAGCTTGGATTGTCTCTACTTTACGCATGAGGTCTTCATTTAGTGTCTTCGTCTTTTGTAG
CTCAGCCAGCAAATGACTGTCTTTTGACCCTGTAGCCTTGGTTACAGCCTCAAGTTGCCCCATGAGCAAGCGTTCTCGCGTTGTTAACGCGTCTATCTGG
CTCTTTAACCGACTGACCTCGCTTTGATTGCCTCGATTTTGTCGGAGTTCAGGAAATGGAAGCTGAGCTTGCTTTTCATCCAAGTCTTTTTCAAGCTGTT
TGCGTCGTTCATGCTCAATTTGTAATTCCTCCTCCAGAGCATCCAAGCGCTTACGGAAAGCCTCCCATTTCGTATTTCGAGCGATCCAGTCACGTTCTTT
CACGATCTTGATAGCGTTCTCCATACTTTGTGCGTTAACGCGCGACTTTTCTCGAATCGCAGTAAGTTCCTGGGCCTTCTTCTCAACCTCCAGCTCAAGT
TGCTGATTTCTTAAAAGTGTCTGTTGCTGTGTACCGGTAACATTGTTGTACTGCAACAAAAACTGCTGATATGTCGTCTTGATCTGCATTAACTGGTGCT
GGAGCTTCCCAACAATAGCGTGGTCTTCCGAGGCAGCCATCAAGTCGCGCAATTGCTCTTCTTGCTGTTCGCGGTTACCTTGTTCCTGAGCAGCTCGCGT
CATAAGTGCATTTGCTTGTGATGCAGCAAGTGAAGCGATTCCCTTGTATTTCGCGCACTCCAAGGCGAGGCTTTCATAGAGTTGCTCAACTTCATTTATT
CTCTCGTACAGAAGTGTGTTCTCGTTCCGCAGCTCATTCTTGTCCACAGCGTTTTCTTCTGTCCCTGATGTTTGCACTAATTCCTCGCAAGTTAATTCTT
TGCACTTGgcctcttcaagctcgtggACCCTCCTCACTTGGTCTTGCAGCTCGCTTTCTAATTGCGTTATACGATCGTGTAATATATCAGGATTACAGAT
TCCATCTTTATCGAAATGTCTGGTACTATATTCTGATTGCAAGACCCTAAGCTTGTGTTGCGCTTGACTTAATTGCGCAGGTAAGTCATACACCTCTATA
TACTTGGCGTGCATCTCCGCATAGAATTTGCTTAAGATGTTGTATTTTTTCAGGACATTAACCatcagctgctgctgcttgtcCACAAACTCACGTAGCA
CACTCTTGTCTAGCGTCTTCTCCATCCGTTCGATCATTTCATCCGCACCATGCTTCCATGTTTCGAGGTACAGGACTCGATATTTGAGTGTCCGCTCCAT
TTCGCTCCACTC