Description :
From Genome Similarity Track
Location :
Scaffold_1815:3841- 6619
Transcript NameFunction/comments
Phypl_g14199hypothetical protein PHYSODRAFT_339182

Sequence
2778 bases(100 bases per row)
CCCTGGACTTTAGAGATCACGAAGTGCACCAAGGGCGAGGATGAGATCTTTGGGGCACTAGCAGCGAGCGTCACCCCTCGATCAGTGGTAGACTAGGCAC
TAATAGCGATTGCGCCTCGGAAGGAACCCCGGCGAGCCATTGAAGTGTCGGTTCCCACAGTACAACCAGATGAAAGTCTCCTGGTGGTCAGTTTCGATGG
ATCCGCGGGTCAAGCGCAGCGGAGGCGCGTTTATCGCGATTGTGTGGAAGATACCTGAGTGGACAGTGATCGAAGCTGCATCGGTGTACAAAACAGACCT
GACGGTGAACGAGGCGGAATATGGAGGACTACTGTTATGTTTTGACTTGCTGCGTGAACTAGATCCGTACCGGCTAATTATTTGTGGCGACTCCAATCTG
GCCATTCGACAGATGAAAGGTGAGATAGACTGCAAAGCCCCCGCTCTGACACTGCTTCGTCAGAAGGCACTACGCCGACTCCAAGAATGGCCACGCCATG
ACTTGCTGCACGTGAAGCGAGCCTGGAACGCGAGCGCCAACAgtccagcgagcgcggccttACAAAGGGAGAGTGGCAGATGGATCGAAGACAGATCGGA
TACCGAAACCTTCATCACACTGAATCGACTGGGTGAGATCCTGATCCCGGTAGCGGAAGGAAGGACCGTCCGAGTTAGTACTGCGATGACAAGGGCTCGA
ACGAAAGCTCAACGTCCCAAGGCCTTGGAAAAGGAAGCAGTGAAACAACTCAGGGTGGACCGGATccgccaagctcaagacgaagaagcatGGGTGGTGA
ACCTGAAGTCGTATATACGAGGAGAGGTACACAATCTGACCCAAGCGGAGGCCAAAGTGTGTAGTCTGCAAAGAGCGGATTTTGAGCTACACGTTAACGA
TCTCCTGTTTTACTGCCCACCATCCGCGAAAACGGAGACGGATCTGGATGGTTTGCTACGACTGGTAGTCCCCGAAGGGCTACAGGCGTATATACTGCAT
CACTATCATGTGAGCCTGGAGGGCGGTCATCAAGGGATCACCCGTACGTTCCAACGGATCCGAGATCACTTCTATTGGAGAGGACTTTTCCGATCGGTAC
AAAAGTTCGTGGGAGAATGTGGAGACTGTGAAACAGGCAAGGGGCGTCCGACGATCCTGGGTAGGTCACCGGGCAACATCCAAACGACCTACTCATTCCA
GATTTTGGCTATGGATCATATCCCATCCTTGCCAAAGTCTCGAAAAGGAAACACTGAGCTGTTGATATGGGTGGACCTGTTCACAGGATACGTCATCGCC
AAAGCCAGCTCTTCACGCACCGCTCAGACTATCGCCGAATCTTACGGAGAATGCGTTTTCAGGCGGTTCGGGGCCAGTGAAACGATCCGCCACGACCGAG
AGCCGGGCTTCATGTCCGACTTCTTCCGTGCATTTAATACGCTCCTGGGACAAAGGCAAAGGACGACCATGGCTTACCGACCACAAGCCAATGGCACAGC
CGAGAGGATGGTGCAAACGATCACGAGGGCTCTCAAGATGTACGTCCAGGATGAGGACCAACGTGACTGGGACGAATATGCAGAGCGATTGACATTCGCC
CTCAACACTGCCCATGATCGGACCCGGGGCGATACGCCATTTTACTTGGCGCACGGATGGGATCCTAAGACTACACTTGAAACGGCACTCCCGGTGGGTA
GTACCCGACGCCGTGACGCGGATCCCCGGAGATGGCGCTACAAGATCTAGCAATACTATCAACGGGCGCAGTCAGGCGTGAACGCTCGACTAAAAAAGGC
CATCTCGGATCGCGCCGAACGACACAATGCAGACGTTACGTGCCATCCGATAACAGCAGGGTCTCGAGTATGGTTGTATTTGGACCGCGTCAAGGAAGGT
TAAGCTCGAAAACTGGCCCACATGTGACACGGCCCGTTCCGGAGAAGTGAAATGGTGGGCGACTACGCCGCCAGACTGGAGACAGAGGGAACGGAATACC
GCCTCTTTCCGGTGGTACATCTCTCCAAGCTGAAGCCAGTCAGATTGTTCTCAGACCACCCCGAGACTCGGTTGACGGtcggaggagacggagcgCTTTG
ATTTTGATGAAGCTCTACTGCCTGAAGACAGTTGGGATCGCGACCTagaagaaggagaacacGAAgtcgaggagatcgtggaaGTCCGGACCGGCCGCCG
TACGCGCTATGGGCGTGCATTAAGAGAGTTCAAAGTGCGTTGGAAGGGACACGCAGACCCGACCTGGGTGAATGAAGCGGATCTAAACTGTGGAGCGCTG
CTATACGAATTCCTACAAGACCGAGCCAAGAGGAACCGCTTCCATGTGATGCAGTcacatgaagaagagcgggATAGTGTATCCAGGAAAGCGAGTAGGT
CGCTGACATGACGAATGAAGAAGGATATCTgcgaggaagctgcagaacaGAGGAGGATGGGTACCTGCACAGCAAGCTGGTTGCTGTGACAGATGATGCG
ATCGATCGTACATCATGTACTATTGGACTTGGTCCACCCCTTGGTTGTCGATGTCAACAAGGTTGTCGCTTGCAGCGGCGAGGCATCAGCCAGGACGCTC
AGAGAACGGAGTCCACGAGCAGGTGCCAGCTCTGGTTGAGGCTCTCAGAGATAACGCACGCATTTGGACATCTCTGCTGCTAAGGTTTGCACTTGAGGTG
CGCGTACAGTTTACACAAGCTTGGGCGCCATGCCTGTGAGGCAACGCGCATGGCTGCGGAACCTTGGGTCCGAAGCCG