Description :
From Genome Similarity Track
Location :
Scaffold_8:3841- 5432
Transcript NameFunction/comments
Physo_338827transposase, putative
Physo_522690transposase putative

Sequence
1591 bases(100 bases per row)
ATGGAGGCTCTTTCCGGTGACAGCCGTGTAAAATTGTCGAAGCGATGCGAGGGCGAGAGTGTAAATGTTTGTCAAGCGCTGGGAAACCACGAACACTGCA
CCCAGGTGGAAACTGGCGGCTCCATCTGATATACCCACTACGAAAGCTGGGTATTCAACTTGACTGAGCTTGAAAGTCGCGTCCATGTATAAGACAAAGT
CCTCGGGGGGGGGGGGTCGGTCCAGTCGTTTGAGAAGCTGCTTCGTTGGAATGCCGACGAAAAATGGTTCAGCGTCTCCACCATCGCCGGCGTAAGGTCG
GGCATCATTGTCAACGGACCACGTAAATATGAACGGCTTGGTTTCTTCTTCATATCCGGTAAAGAAGTGCTCTCGAACAAACGCAGCAATGTCGTCGTAG
AAATCGTTGTTCCCAAGAGTTTTGCGGGCATGGTAATTGACGCAATTTTGTACAGCTCGTAGCGGTGGCATAGCGTCAGCAGGTAGGTTGAATTGATGAC
GCATCAAGCTGTGAATCCGCTTCAGCTTCAGTCGCTGTTGAGTGAGGGACTTGCAGAACTCCTTCTGGCGACTTGTCATCGATGAACGCTTGGGGGACGA
CGCAGATGTGTGATGCCTTCCGAATTCAAACAAGGACGCCACCTTATGCTTTGCGCATGTAATCAGCTTACCCCGCCAGGGGCAATCCAAGTAAGGTACA
GCATGTGCGCAGGTTTTTGACTTGCACTTGAAAAGCCGATAGGTCATCAGATGGGGGTATGGATCCGCGCATACGACGCAGGTCATTGGCTAGCACTTTG
TAGTTTTGTATGACTTTAACCGCTCCAATTCGATGGCAGCAGGCTAAGGGGGAAGTGCTGTTGCTAGCTCTCCCCAGTCGATGGTTTACCCATTTTTGGT
GGAGGAAGAGTCTTGGTTTGTGGGTAAATAAATAGAGCCTCTATGAGCATTCCAGCCACTGACCGCAATATCCAGCAGCTACAGTGTCCACCGGTAGAAA
TGCCTGTGAGCGCTACGTTACTGGTAGGGTCTCATTGGCTAATAAACGAGTTTGGCTGGAGCAATGTCTTCTACAGCGGGTGGGCAAAGTCAGCACCCCC
CATCTCTGTCCTTGGCAACTTCAACACCTTACCAGACTAGAGTGCAAGTGGAGATTTTGATCTCGACCGCGATGAAAGCGGCTTTCTTCTTGTGGTTCGC
TTCGCTTGCCTGCATCTGATTGTCATGCTATTTAACGAAATCCACCAATCAACGGAGCCAAATTCGTTTATATTACATTAGTTATACTGTCTTCTGAGAA
CCAGTCGATTAGACGCAAGCCGAGTTCGAGCTCGAGTTCATTCGAGCAGTATCATATCCCTTTCATCCGACTAGACCCTACATGGCACGAACAGCAAGGC
GTCAGTACTCCCAAGACCTTCGAGACCGCGTCATCCACAAATGGAAGAAGGAGAAGCTGGGCTACAAGAAGATCAGCAAGCACCTGTGCATTCCTCGCCC
AAGCGTGCGCTCTATCGTCAAGTTCTACAAAAAGCACGGACACAGTACCATCCCGCAGCGTACAGGACGGCCTCGGCGAACCAATGACCGC