Description :
From Genome Similarity Track
Location :
Scaffold_1111:3840- 5535
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1111-snap-gene-0.1Cleavage induced predicted protein
Pytve_DAOMBR484maker-pve_contig_1111-snap-gene-0.2Conserved gene of unknown function

Sequence
1695 bases(100 bases per row)
ATGACACCATCGGATATGGCTAATTTTAGCCCGTATGGTCTCATATCCTCGGGGTTGATCGTCGGCACTTGTCTTCCAGCAGCTAACCGCGAACAGAGCC
AGCTGTATGGATTGCTGTTGTGGGTCATCTTGTGGCAGCCAGCATGGCGTCTTGCGTTGGGCATAGAATCGGCACCATTGGCGCCATGTGGCGAGATATA
TGCGGCGCGATGAGTCGGCAAGAGAATGCCATTGTAGGCTGATGATACTGGCTTGTAGATCTTGCGAAACTCGGTTGGCACTACCTGTTGGGACCATGTG
CGAACGCGGTTAGTCCATCTTGCCAGTGAGCTCCCTGGCCACGCTCGTGAACCGTGGTCTGGCATGTCGTTCGACGATCCGTTTAAGTGAGCGGTGGTGA
CTTGGATGCTGTACTCCGCTTCAACGCACGACAGTACGCGGATAAATTCTTGTCCACATGCGTTACTGGAGTTTTGTCGACCGATCCACGCCACCGCGGA
GGCGTTGTCGATCCAGCACCGGGCATGAACCGGCTGATGTTTGCGGCAATGGCTCCATCTCGGGCCCCAGACAAGGACTGCGTACGCGACGCTCATCGCT
TCACGTACGTTGATGCTGAATGCGTTTGTCGACTTCCCCAATACTTGTGCGATGGATCGACGCTCCTCGTCGTCGAAACGCACGCGTATGTACCTCTGCT
CTGCTGGATACAGTACGCATAGGCCTTCATTGCTCGCACCCATAAAGAGATGTACGGCTGGCGCTGGTATTTCGGCCACGATACTGGTTGGGACTCCGTT
CATTCGTCCGTTTTCGAGCAAAGCGTCGACCCACCGCAGATCTCTGGTCACATCTTTCGATAGCCATGTTGGGCCTAGTATTGGGGCGTTGATCCATGCC
CGATGCAGCCGCTGAATGAATGCGCGTGTGGCTCTGCAGCATAAGCCGACATGTCTGAGTGAGCCGAGTAATCGTGAGAGCTGACGCTTCGTCACGTGAT
TGGCTTTGACAGCGGCACGTATTCGGTCTCGGTCTTTCTGTATCTTGTCGGCTGGCATTGACACCGTTCGGAGTTTGGTGTTCCAGACAAGTCCCAGTGC
ACACGACCATGTTTGCCATGTCGAGAACTTCTTGTCATTGATTGCGTGAGGGCCGAGCGTGGCCATCATGCTCAGTTTCAGTGCGTTTCTGCGAGAGATA
GGCGGTTGCCACGATCGACTTCGAGAAGGATGTGATCATTTGCCCAGACGAACGAGAAAATGGGTCCAGATCGGGATTGCTAGGGTCTAGCGTGCTTGGG
CTTTCTCGTGCTACCAGGAATGAGATTGCTCCTCCAAGGGCCCCGTAGTGCGCTGGTGACCCGGTCCAGCCGAATGGTAGTGCGAGATTGATGACGGTGG
TGTCTTTTCGGTACGACACTGCGGAGTGGGACGCGAGACTTGACGACACCGGGATGTGTCGAAACGCGCTTTTGACGTCACCTTGAGCATTTTTGCGGGC
AGGTTCGGGTATAGTGTGGCAAGGGCTTCGATCCGGAGTGCTATACGGCGGACTGATTCGAACGCGAGCGGGGGTAAATCAGATTGTGCCGATCTGGCGT
TGACGGCTGATTCGTCGGTGTAGGAAAGATCGTGAATCAGCCTGGCTTCGTAGGCTGGGTCGATGTCCTTCTTTGGCACACATCCGAAGGGACTG