Description :
From Genome Similarity Track
Location :
Scaffold_1678:384- 7386
Transcript NameFunction/comments
Pytar_ATCC12531fgenesh_masked-par_contig_1678-abinit-gene-0.2Microtubule-associated protein

Sequence
7002 bases(100 bases per row)
GAATACGCACACGCCCTCGCCTTTGTCGTGAGCTTGGTCATCGCCAGCAGCTTCTTCGTGTCCATGTCCCACACTCGCAGTGTGCTGTCGTCGCCGGTCG
TAACAAACTGATGTGTGCTCGGGTGGACAGCGAGCCCCCACAACTCGAGGGAGAAGTGACCAGAACATAGCGGTTTCCCTCCATGGAGAACGGTGCCACT
GGCCATGTCGACCTCCAGTATATCGCTCGACCACGTGCCGATCAAGAGCCGCTGGCTGTCACTGGACAGACACGCACTGGCGATTGCCTTGTTCAAGCAG
CCCGTGCTGAGCGCACCCAGGTCCACGGTCTTGAGCGGCTGATACGATGTGTTCCACAGGACGACACGGCCATCCTTCCCACCGCTCATCAGCAAAACAG
TGGGGGTCTCGTGGCAGCACACAATGGTCGACTCGCCGTCGTGGGCCTTGACGACTTTGCTCAGGTCATCCCCCGTCCACACGTAGAGCTCGCCTCCAGC
CGTGCCCGTGACAAAGTCACTGCCAAAGAAGCACCCCGTGGGGAACACTTGTAACGATCCTTTCTTACCGACTTTCCCCTTCTTCTGGACCAGCGTCTTG
CCTTCAACGCGCCAAAACAAAACGTGCTTGACGCCGCCCGTGACGACCGTGGCCGCATCGCGGCCAAAGCAGCTGAAGCGGTTTGCGGCCTTGTCGCCCT
TGGACATCGCGACAAGGTTAACGAGTTTCCACGAGCCGTGGCTAGCATCCTCCCACACGGCAACTGAGTGGTCATCATCATCCCCTACAGTCACGAGCCT
CGAGGCGTCCTGGGAGAAAGCCAGCGACACGACGCCGCGCGTGTGGAACCCCTTGAGCTCGCTACGCAGCTCTCCAGTGTGAGCATCCCACACGCGCACC
ACGGGCCTTTTCCCGCGTTCGCCCGTCGCAACAATATCGCGCGACGCCGTCATCGCAAAGCTCAGGATGTCGTCGTTGTGGTGCAAATGGTGCTTCTGCA
GGTGGTTCTTGTGGTCGAAAATGACGCCAACGGCCGCCGTGTGGTACACAATCTCGCCGTGGGAGTTGTACACGAGGTTTTGCTTGGAGAGTTCCGTGTG
GTATCCGTAGACCCAGTCCAGTTCGACGTGGACGTCGGGAACGCGGGAGTTTGGTGCTGGCGCATTGCTGGGGGCGACGATCGCGCCGAGCCACGGCTTG
ACCGCCAGGAATTCGTCACAGTCAATCTCATCCATGTCGTCCTCCGGGTCGTCTTCGTCGTCCTCCCCAATCTCAGACACAGTGGTGGCGACGGAGGCTC
TGCTCGGATCCTGTTCCTCGACGTCGTCGCGCACGACTCTCCATTCCAAGAGGCACCGATCGTTCCCGCCGGCACTGACCACATACTTGTCATCAGCGCA
CCACCGTACGTTTGTGACATGCGACGAATGGCCGCGGTGGTCGATCGAACTCGAGTTCTTCTCGACGCACGGGTATCGGAAAAGCTTGACGAGTCCGAAG
TCGTCGGCGGTCGCGAGCAGATCGCTCTTGTGATTACGGTCCACGGCGTTGACGTCCGTGCCGTCAGAACAGGGCGGCCAGATACCCTGCACGGGCCACC
CAAGTACGCATGTCCACGAGTCCCAAGTGACGTCTTTGGTGCTGGTGGCCGACGTAATATGCTTGCCAGTATTGGCGTTGCTAAACAGCAATTCGTAGGC
CCCGCAGTTGCTCTGTAGGAAGGAACCGTCGGCGGAAAAGTCGAAATGGGACACGTAGCTTTGATGCTTGGCGAAGACTCCCGTCTTGGTCACTTTCTTG
AACGAGGCGGGATCCTGGATCCTGTACAGGTAGATGCAATGGTCGTGTGAGCCTACAGCCATGGCCAAGCCATCGGGCGAGAACTTGACGTCGCTGATCG
GCTGCTTGGAGGGCTTGTCCTCAAAGAGCTTATTGTAGAGCTCATCATATCGCACGACTACGACGCATCCCGACTTAGCGTGGATCTTGGCATTCCGCGC
GGCAGCCGCGGCGTGGCGTCCGCCAAACCCAATCGCCACCACCTCCATTTTGCCCGACGCAAAGATCGCACACGCACGCGCCATGGTGTCGAGCTGGAGG
TGTCGTAGGAGGCACTTTTTTTCCACACTCCACACGCGTAGTGTCTGGTCATCCCCTGCTGAGCAGTATTCCGGGCGACTCGGGTGGGTGGCTAAGCCCC
ACACTTCCATTTGCGAATGGCCGCGTGCGATCGTATGCATTGAGCTAATAAGCGTAGCGGGTCGGCTCGCATCAACCTCAACCAAATCGCTGCCGCGTGT
GCCCACTAGAAAGCTTCGCGGCGATGATCGCGTGCCCGTGCAAACACTACGGATCTGAGCGTCAAGAATGTTCAGGGCCGGTGCATGCTCTTTCAGATCA
AACTTGAACGTGTTGCTGAAGCTCGCGTCCCAAACCATGATCGTGCAGTCTTTGCCGCCGCTCACGAGCTCTTCCGAGCCAGTCTTGTACAGCGCGTATG
CATTGGACGCATGGGCTCGCACAATCCGCGAGAGCTCGTTGGATCCACCTTGGAACACATACAAGTCGCCGTTGGACGCGCCAACGACCGCGTGGCTGCC
AAAGGACACAACACATTCAAATACGCCGGGCATTGTGTCGTCCTTGTGCTTGGCTTTGCCGAAAATCGCTTTCTTGGAGGTCATATTCTTACCCTGTTCG
CGCCAGAAACGAACGTGCTTGTCGCCACACGATATCCACTGGTCCAGATGATAGCAAATCGCACGCACGGTGCTGCGCTCGCCCTTGGCAGACGCTGTGA
GCAGTCCATTTTCCCACGAGTATATCGCGACTGAGTGGTCGTCGTCGGCACCGACGCTAGCCAGCTTCTTGCCGTCGGACGAGAAGCAGATCGCGGGCAC
GCCGCGCTGGTGGAACCCTTCCAGGCATGAAATGACCTTTGTGGGGGCGTTCGAGTTCCACGTGTAGATCTTGGGCTTCTTCCCCATTTGTGCAGTCGCA
AACGTCGTGCCATTTGGGTGTATGCAAAGCGCAATGATATCGTCGTCGTGACACTTGAAAAACGACTGCGTTTGCGTGGCTTTATCGTACACGATGCCCA
GCGCGGCCGCGTGGTACACGACCTTGCCCTGCGCGTCGTACCGGGCGTTGTTGGCTGCTTCCTGGGCCTGATATCCATGGACGCGGTTTAGCTCGAGCTG
TGCGTCAGGTGCCGACGAGCAGAGTTTCAAAGTCTTGGCCGCGCTGGGCGGCACAATCGCTCCGAGCCACGGTTTGACCGCCATGAATTCATCGCCGACG
TTGTCGTCAATGGCGTCGAGCGGATCGCTTTCTTCGGCTCGGGTGCTTGCAGCAATCTCTCTTCTTGTAACATCCTTGGTTTTGGAAGGTGGCTGACGAT
CTGAAACCTCTCCAAGGTCCCGAGCAGACCCCGTGGCATCGCTGTTTCGCCAAACAAAGAGACAACGGTCGTTGCCGCCCGTCGAGAGCAGCCACTTGTC
GTCGGACGACCACTTGACTTTGGTGACATGGGACGAGTGGCCACGAAGCTCCATGTACGATGCCTTTTCAACGGCGCACGGGTACCGGAAGATCTTGACC
TTGCCAAAGTCGTCACCCGTGGCCAGCCACGCACCATCCCTTGACCGATCCACGGCGTTAACGTCCGTGCCGTCGCTGCCCTCCGCCCAAATGCCCTGGA
CCGCCCAGCCCAGTGTACTCGTCATCGTGTGCCATCGCTCATCCCGCAGTGACGACGCATTCGTGATGTGTCTCGCGGTCTGCACCTCACAAAAGAGCAG
CTCGTACCCGCCGCACGTGCTCTGGAGATGGAGGCCATCGGATGAGAAATCGATGTGACAAATGTAGCTCGTGTGTTTTTTGAAGGACCCGGTCTTCTTC
GAGAACCCTTTGAGAACGTCGTAAAAGTACACGACCGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGTCCGTCGGG
CGAGAACTTGAGGTCACTTACCCATTTCTTGGCATCGTAACACGGCTCCTTGACCCTGGCGAGATCCTGTTCCGAGATAACGACAAATCCGCCGGCCGGT
TTCTTGGCGCGACTCGTCGATTTCGCAGACGAGCGAGCAGTCGCGCTGCCACCGCCATCCGCGCCCAGCCCCACAGCGATGAGCTTGCCATCAGGCGAGT
ACGCACACGCTCGAGCGGGCAGCTCCAGGCTCACGGAGCGCAATTCTTTCTTGGTCTCGAGATCCCAGATCCGAAACGTCCGATCGTCGCCAACGGTGCA
GCATTGAGCCTTGTGTGGGTGGACATCCAGTCCCCACGTTTCGCCACCGAAATGGCCAGTCGCCAGCGCATCCTCGCGTGCGTTTTTGCCCGTTTTCGGA
TCGATCTCGAGCAGCTCCGACGCCGCCGTGCCCACGAGAATTGCCGTTTTATCTGGTGAGAGACAGCAACTGCTCACCGCTGGATGAAGATTGGAGAGAC
CGCCGCTGGCGTCCTTGATGCTGAACGGACCGGCGATTGGCTTGAGCTTGTCATCTCTTAGCGACACGAGACCGGTCTTCGTGCCCACGACCAGTGTCCC
CGAGCAATAGTGCAAGGCCTGGACGGCACCGCCACCCTCACTCTTGACAACGCTTGAGAGATCGCGCCCCACGAATGCGTAGAGACTTCCGTCGTTCGCG
CCGACCACGAGCGAGTTGCTGTTCCCTATGTACTCGGCGACGTGGAATGCTTGTGTCGTGCCCTTGCTGCCGAGAACGGCTCGCTTGTGGGATAGCACTT
TACCGTCCAAGCTCCAGAAGTCAATGGTCTTGTCCCCACAGCACACAAACTCGGTCATGGTGGACGACGGGTTTGCACACAGGTGGAACGGCACGGCTTT
GTTGCCCTTGGCAAAAGCGCGGAGTGTCGCAGTCTTCCACGCATCCTTGGTCTCATAAACGGCGACGCTGTGGTCGTCGTCTCCACCGACAGATACAAGC
GTGGCATCGCCGCAAAAGGCGACGTGGAGAACACTTCGCTGATGGAAGCCTTGCAGCACGCACAGCGTCTCGACCGTGTGAGCACTCCATACATGGATCT
TTGGTGCCTTGCCGAGCTCACCACTGGCGACGATCGGTTGCTTGGGGTGTACGCAGAGGCACCGAACATCGTCTGTGTGACCCAGGTAGTGGCGCTNNNN
NNNNNNGCTGGCGACGACCGGTTGCTTGGGGTGGACGCAGAGACACCGAACATCGTCCGTGTGACCCAGGTAGTGGCGCTGCACGTTGGTTCTAATGTTG
AGCACCACGCACGCCGCTGCCGCAGGGTAGACGATATCGTCCGCGGTGCCTGGACAGTAACGCGCACTGTTCTTGGAGTCTTGGGCGTTATATCCAAAGA
TCCACTCGAGAGCAAGCGACAACACTGGCGCAGACTTGTCCAGCAAGGGGAGTTTACTTGGTGGCACANNNNNNNNNNCGCAAGCGACAGCACAGGAGCA
GACTTGTTCAGCGGGGGGAGTTTACTTGGTGGCACAATTGCTCCTTTCCACGGCTTGACTGCGAGGAACTCGTCGCCGTAGTCGTTCATAGGAATCGGAT
GCAGCGCGAGCGTCCGCTCTCTGTTGATATTGGCCTCTCCGCCACTCTCCNNNNNNNNNNGGTCGTTCACTGTACTCGGGTTCATCGCGAGATTGGCCTC
TCCGCCACTCTCCACGACAGCACCCGCGACTTCTCCTTTTGTGTTCATCGCACGCCAAGAGCTAGCCCCATCGTCATCTTCGTTCTCGTCNNNNNNNNNN
TGACAGCACCCACGACGTTTCCTTGTGTGTTCATCGCGCGCCAAGGGCCAGATTCATCGTCATCTTCGTTCTCGTCATCGTCTAACTGCCTCTCTGTTGG
CGATGCGTTCTCGACGCGGTTGAAGACGTCAAAGATTGCTCGCGCCGTTTTATTCTCCATACAGTACGCTCGAAATTGGTCGCATGTGATGGTCACTTGG
TTTACGCTCGCTGTGGCTGAAGAGATCTTGGCGATCTCGCGAAACACTCTCTCTGCAAGCACTTCGATTTCGTCATCGTCCAGGAACGGAGCGCTCTTCT
CGCTCGCCGTCTGGCTCGACAGTTTGAGGATCTTGGCCAATCCCAGCAGCGATGACTTGAGCGAGATCGTGAGCTCATCCATATCCAGTGCCCCATCGTC
GGACATATCCCATGAATCAAACAGCAGATCGATCTTGTCTTCGATGGGCACGGCTGAGATGAACACTATGGCGGAGAGGAACTCAAGTGCGTCCATGACG
TCTCCACAGACAAGACTACCAGGTCCTGACCCCATCACTTGCGACTGCCCAGTCAGCCGAACGGCAAAGACATCAAAGACGTGGTCCGCGTGGGCCATCG
CGCGCGCCGACGACGCGTGGGCGTCAATCAGCCGTCCGGCCTTGCTGCAGACCACGCGCAGCTGCGCCCGCGAGAGAGCGAAGGACGTCGCATGGTCATA
GAAGCTGCGCCAGTACGCCTCAATGTCTCGTACGTGGAGATTGTCGTACGGCAGCACAGCCTCCACGAGCGCCACTCGCGCAGGCTCCCGCAGTGCCGCC
GTGATGGCGTTGCCCATGCTGAAGATATAGGTGATACCACCCGCACCTTTTCGTGGCTCTTGGATCCTGGAGGCACGGGTTTTGACCAATCAGCGGGTTG
AACGCGGTCTCTCCCNNNNNNNNNNGTCAAAGACGTGGTCCGCATTGGCCATCGCGCGCGCCGACGATGCGTGGGCGTCGAGCAGCCGTGCGGCCTTGCT
GCAGACCACGCGNNNNNNNNNNATGGCTCTTGGATCCTAGAGGCACGAGTTTTGACCAATCACCGGGTTGAACGCGGTCTCTCCCACTGTTGTTGCTCAA
TTAGGACCTCTTCCTCGGTCTTTATATAGTCAAATTTTGTTGCTAAATCAAGACTCTTTACGGTACGGAGGGCGTGACTCGGTTTTGCTGGAGGCGCTCG
CT