Description :
From Genome Similarity Track
Location :
Scaffold_1396:384- 4161
Transcript NameFunction/comments
Phyta_totarag12877glucan 1,3-beta-D-glucosidase
Phyta_totarag12878hypothetical protein PHYSODRAFT_301637

Sequence
3777 bases(100 bases per row)
AACTTGTTTTTGGGTTTTACCGGTAGTTCGATCAATtccggtacatgtattaaaaACCCTGACAGAGTCCAGGGGGGAGGGGGGATTAATACTATGGATT
GGATTTGGTATTCTGCACAGCGCTTTCATGTATTGGTAAAGCTGTTTTATCGTGACTCACTCACATTGTTCGTCTAAGCTAGACTCGAAGGCCAGTCTGC
GACCGATGCTTACATGGCGCAGTCCTTgtgcgacgacgtcgtggtggtcgagGTCTGCGAGGCGAACGTGTCGTCCTCAGCACCGTCCCCATTGGTCTCG
CCATCCGAGGATGCGCCCATGTTGGTCTCGTCCTGCGTCGTGGCATCCGTCGTCGAATCGAACGTGATGGTGGCCGAGTCGCTGCCGTcgaaggacgagg
tggagtTGTCGAACTCGGCCGAGAGGAGGTCCTTGAGGACGCCCTCGTGCGTGAACAGACCGAAGTACGCCTCCACCGTCTCGTTGGCCTCGAGCGTGGC
CAGCTTCCACGGCTCGTCGAAGGCCGAGAAGTAGTAGTACGTGATGTCCTTCTCCGCGGCAAGCGTGTAGAAGTCGTAGAAGAActtggcggcgttggcg
gccGTGGCCGGGCTGGCGCCGGCGCCCTCGCCGTCCCATGCCCATCCGGTCTCGCCCACAATCACCTCCTTGCTGTAGGTGCTGGCGGTCTCCACAAGCG
CCGAGAAGCGCTCGTAGAAGTGGTCAGCGGCGCCGTCGATGGCCACCTTCTCCCAGAACGGGAAGTAGTTGGCCGACACGTAGTCCACAGCCTCGATCAG
CTCCGGGTATGCCGAGTACGTGTCGCCGATGTCGGCGATGGTGAGCGGGATGCTGGCGGCGCCCGAGTTGGCCTGGCACAGCGTGCGGATCTCGTTCAGG
TTGGAGATGGCCACCGCGACCGTCACGTCCTCGCGGTACACGGCCTCGCTGCCCACGTGGATGCCCTTGATGTTGTCGGCAGTCACGACGCcggtctgca
gcagcgtttggaacgccgccttctccgcctcgaagctggacgtggacgagtcCACCCACATGCCCAGCTCGATCTTGAGTCCGGCCTCGATGGCCGCAGG
CACCACTGCCGTGGCCTGGTCGCAGTCCGTCAGTGAGTACAGACGGATGGTGTCGGTCACGTCCTTGAGCGTGGCCAGTTCCGTGGCGATCAGCGAGGCG
GGCTTGCACTTCACGTCGGCCGCGGCCCAATCCGGGCCGGCGCGGATGTTGTAGTTGATGCCCgtgcacttgaagctgccggcATTCGCTATGtcgaagg
tggcggcggccatGGCCAGAGCGGAGGTCGTTCGCAGCACGTTCACCATGGTGGAAATCGGTTGTCGCTGTCTGAGCTTGGGGGGATACTCTTATCGAGG
AGATAGGAGTTTGGGAAATGACACATGACACTCAGCACACGCCAAGCCGGAGGCCGGAGGCTGCAGGTCTTGGCAATGGCGTGTCATGGTGAAGCCAGGT
CTAGGCTGCATCTCTGCATCGATGTTCGCGCGCCAGTGCCATCTGGATCGCGTGTCATGGCCACAACTGGACGTTCCGCTTGGATATTTCGGCAGCCGAA
GCACCGCAATTGGCGAAACTTGTCAGCAGTTTGTAAGTACGTCAGCGGCCACGCCGGTCGGATTTGCCAATGGAGCACATTTAGTGAGTGGAATGGGCGT
GTGGAAGGCACGTGGTGGCCACGATGGCGCCACATATCAGTAGCATtggaactacatgtagcgcgTGCGTGAGCGTTCGGCGAAGGTGGGCTCCGTTAAC
AATGAGGCGCTGTCACTACAGTACCGGtaacagcagcggcggcatgCATTTCACTTGATTTTCCTGTTCGCAGCAGAGAGCTTCGGAGCTTCCTGCACAA
ACGACACTCGGAGTCGCCCTTCGAGCTGACGACCGACGCGCGTCGAAAGCAGCCAAATCCAGAtgcagtcgtcgctgctaGTCTACAGTACaatgtactg
tactgtacatgtagctgaAAGTCACAGAAGCACAtatgaactacatgtacactgtatTGGGCAAGTCCAGATGCGCCGTGCCAACGGCATCCTCGCTGCC
GCTTCAACGTGGACACAgcgttacatgtactcctGCAAATGCTTCGGCCAACCTACAGGCAAGCGTTACAACGTAACTTGAAGATAGCTAAGGAAAATTG
TTGTGTACTTGCAACGCGTGCACTTGTATTGTCAGGAACGCAACATAAAAACATAAAAATTGGGGCTTCacgatgcagcagctactgtaAGCCTTAGATC
ATAGCGCAGTCtttgttggtggtggaggtggccgtatcgtcgtcgtcgctttcGTCCTTGTCGGTCGACAACGACCTCCGTGCCATCCCCCTCGGTCTCC
GATGTCTCATTCGCTCCCTCTGCGAGCGTCGTCGTGTCAGCTTCGTCGGAAGCGGCCTCTCCAGTTTCGGCGCCCATTCTCGGTTTTGGACGTCACGGTG
GACTCGCTAGCCACGACTTCATCGGCGACctcgagagctgcagccaagGACGCGTCCGTCTCCTCGCTGGCATCCATCTCCGCCGTCGAGCCAGCTTCGG
AACTGTCAGTCACAGTCTCGAtagcctcttcctccgttGAGCCGGCAGCAGaggctgctgccgcctcgTCGTctagctccagctccgcgacGGCTGGCTT
CATTTCGCCGTCCTCGTAGAACAGACCGAAGTGGGCCTCCACTGTGTCGGTTCCCTTCCAGGACTCGTTGAATACAACGAAGTAGTAGTACGTGATTttt
gctcctgctgcaggtaGAAGTCGTGGAAGTACTCGGCTGAGTTCTCCGGGGTGGCTTCGCTGGCACTACCGTCCGTTGGTAGCCCACCCGGTCTCGCCGA
TCACCACACTCTTGTCGTAGGTGGCCGCAAGGCTCACAAGTCGCTGGTAGGTTGATAGAAAGTATGCGTCGGCCTTGGCTGGCACAACGCTGTCCCAGAA
AGAGAAGAGGTTTGCCGACACGTAGTCGACCTCGTCAATGAGGTCCTGGAATGCCAAGTACGTGTTGCCCACGTCGGTGATCGTAAGAGGAATCTCAGAT
GCGCCGCCGTTGTCAGAGCACATTTGGCGGATTTCGCTCAGGTGGCTTACCGCAGTGTCGATATCCTCATCGCCGCGGTAGATCGCCTCATTTCCAACAT
GAATGCCCACGGTATTGTCGGGCGTGACGACGCCAGTGCTCAAGAGCGTGACGAACGCCTCCTTTTCGGCCGCGTAGCTGGTATTGTACGAGTCCACCCA
CAGTCCCAACTCGAGTTGGAAGCCCACCTCAATGGCGACGGGCACAAGTGCAGTATCCTGGTCGTAATCGGTCAGCGAGtacagacgcagcacgcTCGTG
TAGCTCTTCAGGGTCTCGAGCTCGCTGGCGATCTGCGAGGCCAGCTTGCATTTGTCCTCTGCGGCCGCCCAGTCCGCGCCGGCGCGGATGTTGTAGTTAA
TACCAGGGCAGTTGAATGCCACAGCTTCCACGGAGTTGGCTGCGACGGTGACCAGCGCTACGACTGCGAGGATTGAGGACGTCCCGGTGACGTGAACCAT
CTTGCACTTGTTCTTGAGTGAATCGGAAGGAGCAATTGGCGAATGAGCTCGTACTTGCATGAGGATCAGCGCAGATTGACATCTCTGGGGTGGTCTGAAG
CGCTCCATGCTTCCCGGAGCAGTGGTGTTCGAAGGCGTTGTCGACTCGGTGTTCGAAGTTACCTTTCATCTACGCAG