Description :
From Genome Similarity Track
Location :
Scaffold_2022:384- 3364
Sequence
2980 bases(100 bases per row)
GGGGGCAATAGAAGAGCAAGTCATTCAGATCCACCGCGTAATCCATGGCGCTAATACTGTAGGATTTGGTATCCTCCCGACTTAAGTCTCGTACATCCCC
CATCAGATACTTCTTTAGTCCCAGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCACAATGCGGACTCTCTTCACGAATGTTTCCTCGAGGATC
GGGGAACTGGATCCAATCCTTCCTCTGGACCTAGTGACAGCCATCACCCGGACTGTCCTTTTCCCGGACCCCACTACCATCACTTCGTCTAGTCGGTTCA
ACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCAACACCGCATTGATTCCGTAAAGCGGCGCTGGCCAAGCTATCTGCACTGGCATTTCAATC
TCGCTTGACATGCACCAGCTCGTGATTCATCCAACCGCGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCA
CCTCGCACCTGTCTGATCACCAAATTTGAATCCCCACAAATCACCAGCCTTTTCGATTCTTGTCCCTTTAGTAGATCCAAACCCAGCAGTATCCCGATAT
ACTCCGCTTCGTTGACGGTGAGGCCTTCCGCATAAGTGGATCTGGCCCGTACAACTTCCCATCCAGGTAGTCTCCACAGTATTGCACTGTACGCCCCGCC
TCCGCGTTGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCGTCTGCCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCT
TTCTTAGGAGCGACCCTAGTCAGCGCCTCATCCATATTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATT
TCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAGGCTAGCGTAGAGTGTCG
GGTCAGGATCTGGATGGATCTTCCCACCAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTGGTTCAGT
TCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGACCCCCTCATGTCCTTGTACCAGAGCTGCTGAGACTGCCCAGTCGCTGGCATAAA
CTATTACCGTAGGTTGACGTTCCGGATCGAAGTGACGGAGGATAGGCGTGGTCGCGATTCTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATTCA
CCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCGCCGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCC
TCTTCTGGCGTCGTACCACTTGGATTCCTTCGTGGATCCGACATTTCCCGGGCCAGAGCTTGTTGGATTTTTATCCGGACAGCTGGAGTGGTCATCGCAG
CAAAATCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGACTGCAT
CGCCCGTAACGACTGCGGGAAGGGCAAATCAGCTAACGAAGAAGGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAACTCGATGGCCTAAGTAATCC
ACCTTGCGCATCCCCCAATAGCTCTTTACCACACTGATAGAAAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCGCACAACTGATCCC
ACGATTTCGTCTGTATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACGGACGGGGTTCCAGGATCCCCTGGCTCTCCTGCCTCAAATGGATCTAC
TTCCGTATGATCTTCCCCGGATCCACCCCTTTTGGGTTCCGGTATTCGGGTGATTCCATAGAGAGCGTTATCGATTAGACGTTGGTAGATCTGGGGTGCG
TTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGGACATCGCGCGAGCTCGATCCGTCATAGTAACTACCCAAA
AACCGCTGGCCATGTCAAGAGAGCAGTACCAGAGTACTTTATCCAGATCTTCCAACAGCTCATTAATTAGAGGCATCGGATACACCATCAATCGAGTCAG
ACCGTTAACCAGCCGGTAATCAATGCACAGACGTATGTCCACCCCGTTCTTCTTGATGGTGATTACCACTGGGGATGCTCACGGGGACGTTGAGAAACTG
ATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGCGCCACCTTCCTCACCCTCTGAGCGATCGGTTTCGCGTCGC
CGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACG
ATCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCT
TTGTGGTGTTGGAAATCCCACGTGAACTCTAGCTACAGATGTAGTTAGGATGTTCCCACAACAATACGTCTACTAGGATAGTAAACGATCGTTCGGGCGG
ACCTGAAGACCCCAGTTCTGCCCTTGCACCGGGACAAACTGGACCTTGTAAACTACTTATATAGGCCAGCCAGTAAAATAAGAACACGCTACTAGCACGA
GCAAAGCTAGCAGGTGTTTTGAATCCTCGTGGTCCCAACAGCGGAAGGTTACCAGGCACGGGTAAGCCTTTTACGAGATCACCGAGTGTTCAACACTCGG
CTGGAAGAAATAAAAGGGAGGCAATTCAAGCACTCCCAGTCGTGCAAATAGGCAACAATAAGCCGTCACGTAAAACCTCC