Description :
From Genome Similarity Track
Location :
Scaffold_2771:384- 2116
Transcript NameFunction/comments
Phyag_g12787hypothetical protein

Sequence
1732 bases(100 bases per row)
AATAATCGGATAGGCCTCTTTTTCTATCACTGACCAGTTCAATTGAGCACCTTTGAATGTGCCCCCTTTGCAAACtagcagctcgtgcacttGCTCATGC
ACAGGTATGTCCACTTGCCAATTCATCACCTGAGTGAGGACCACCGCCCACCCAAAGTGCGACGCATCTGTGCATAAGACCAGAGTGGCCTCCTGGTCTG
GAAATGCTAGCTTGGCTGAGCACGTCAGCAGTTCAATCAatgcagcaaaagctgcttcagtttcGGGCTCCCATTGAAGTTGGACTCCTTCCGCTAGGCG
TTTCTTTCTGCTCTTCCCTTGTAGCGCTTCTGTCAGTAGGTGCTGCAATGGCAGCACCACACGTGCGTAGTCCACTAAGGAATCGCGGATCCAGTTAGAA
GCACACAACAAGTGCTGAAGCTCCGCAGCCGTAGACGGGAGTGGAAGCGAGCGCAGTGCCTCGAGTCTAGACGGATCATGCTGCACACCATTTCCGTCCA
CAATCTTTCCACACCAGTGAATTGTTCTGCAAAACAGCACACACTTCTTGGCattcagcttcaagttgTATTCACGAAGGACCTGTAGGAATGCAGCCAG
TCGTTCAAGATAAGTATCATCATCCGTAGCGTAAAGAGCAATATCATCAATCCAGATAAGGACACACTCATACAGCATATCCCGGAACACACCTTGCATC
TGTGTCTGAAAGTGGAGTGCAGAATCCATTGCACCCTGCGGTACGCGCGTCGGCGTATACACCGCATCGCCGGTCGAAAAGCTGAAAATCTCTTGGCTAT
CTGCAGCTAATGGCATCTGCCAAAAGCCTCGGAAGAGGTCAAAGGTGCCAAAGCTTGAGGCGCCTTGAACTCTTGCAGTCACCATCGCTAGGTTCGGAGT
GACACCTGCAATTGGGATTGTTTTGCGGTTCACCGGCCGATAATCGGTGGTGATCCTGAAGTTGGTTGTACTTCCAGTTTTCTTcactggaactgctgca
caGCACCACTTGCTGTGGTCGTTGCGACGAACAAACCCAAACTTTTCCAACTGCTTCACGTACTCACTTAGGAATTGGTTCTGGAGCTCCGGATATTTTC
TAGCCTTACAGCGAAATGGCTGTGCATCCTTCTCCAGAGTCACGCTGTATGGCTCcacacgagcagcatcaTCCGGCCCAATGCTGATTCGCCATACATC
TCTGTACTCAAGCACAATAGCTCGCAGCTTTGGCATAAGTCGAGCAGTAAATCCATTGGCTTCTGCATCTCTGAGCATTCGCTCAAGACACTCATGAAGT
TCATCATCAACATCAGTTCCGACTGACGGCTCTTCTGCAATGTCATCGCCCGCATCGCCATCAATCGATGTACCAgcaagctgctccagcatgtGATCAA
TATCTATTCCCAGCAGTCTCAGTGTGGTATTGCCAAGGAGaaaatcttcttcatcaccggCCATAACAACACACGGAGTACGGCGCACGTGGACAGGACC
AGCAGCCGTCGTAATGCGAAGATCCACAACACACTCGTCCACGCAAAACACATCCCTGCCGTCGGCCAACGTGAGTGCCAAGGGTGGATCCAGAGCATGC
ACTTCCACAGAGTCATCGGCATCCAGCAGTCGAGTCATCACACGCTGCGAAATGATATTCCTCTCGGCTCCCGAGTCAGGACATAAGTCCACCTCAACCT
TCCCATTAATCAAAGCAGATTGCCCACCAATC