Description :
From Genome Similarity Track
Location :
Scaffold_9:383906- 386338
Transcript NameFunction/comments
Physo_306680Protein VPRBP, partial

Sequence
2432 bases(100 bases per row)
TTCTCGTCGTAAGTAATCTTGGTACTTGCAACGATGCTTGCCTTTTCAATTTTCCTCACAGTAGGGTCCGTTGCCTCGTTGATCACGACGTTGGACGCTC
GATGCGTCACGTGAGAAATCAAATCCAAGGCAGATTCCCGAAAGCGCACGTGAATGTCAGCGTTTTCCTCCAAAACTGGATCACTACGAATCATATCGGA
CAGTAGTTGCCCGACCTGCATCTTCTCAAGAATTTGGGAAATGTGCCGGTCGCGAGATAACCCCAGCAGCGCACGCGTCGCCAGAAGTCGAATTGCATCT
GCATTCTGCACCGACCGCTTGTACCGAAGTAGATAGACACACACCTTGATCGCATTTCTCTCCCTCGCCAATTTTCGCACAGGCCGCAACATTTTGTCAT
CTTTAGCTTTAGAACAGCAGTTCGAACAGTTATCGGGCGTAGCCGCGTTCGGTCCTTGGTCTGTTGTCTCCGAGCTTGAGCGTTGCGCCTGGTCATCTTT
CTTCGTTCTCATGCTTCTAGCAGTCAATGTGTACTGCCGGATGTCTTTGTAAGGGTGTTGCCAACAGTCTTCGTGGTGAGGTGGAGACACACAATTGCAG
AATACTCGCAGCGCATCCCGAACCAACTCCGAGTCTCTTGGATTGCTGCTCATTGCAATTTCCAGCAGAATCGCCATCCCAAGCTGCTTGGAAGTGCTAC
CCTCGTCTAAGGATACTTCTGTCGAGCATACCTCACTAGCCAAAGTGGGAACCACGAGCGTCAGAACGCGAAGAGAGTCCAAGCAAAATTGTGCGCGTTC
TCCGGTCCATATCCGTATAGTCGAGGAGTTAGCATCCGGATCAGTATTTTGCATTACTGAGCACATCATAGCCACAACCTCCAAAAGCACTAGGATGCCA
CGCAAATGACTGAGTTTTGCGGCGGGAGGCCACATCCCATTGCCTGGACCGGTTGCAGCAGACCATGAATTGTTGGAGTTGCCACTGCTTGCACTGAAGC
GATATTTCTCGTAAAACACCATATTTTGCTCGTGAGTCTTGTCGTCGAGGTCGATTGCCTTAGACCAGTTAATTTTCGGGACCCGAGCTGGGATTCGAGA
CGCCGCGGTTGCCGCCGTTAATACTGGCGCTGTGTTTGACTGCCGATTTGACGGATGGTTCAGTTGTGCAAGCTTTCTCCGGAGCCGATGCGTCACCATA
GCCATATGCATACGCACGTACTGACGCAAGCACAAGCAGGCATCTTGAGCAAGTTGTCTTTGTGCCACTGATTTCGGGTGATTGCCCACTCGGATGATAT
TCAGGATAGTGTACAGTCCATTGTGCTTCTCGAAGTAGTCCAGAATCGCCTTGAACCCCAGCGTCAAGCTGAAAAACACCACAGCGTTCTGTCTTGCACG
GTCATTCGGGCTGGAAAGCAGAGTAAACGCGGCTGACAGCATGTTTTCCGGACTCATCACAACCAGGCGCTCAATAACTGCAGACGAAGATGCAAATCCG
TGAAGGCACATTGAAAGGCTGCGATCCAGCAAACCGACTTGGCCAGCTGCTTGCTGTAACTTGAATACCGTGAACAGTAGGTCTACTCCCCCCGACTCAA
CAAGCGAAAACGAAAACTTCTTGTGCGCGAGGAAATGCGACGTTAGCGTCATCGTGTGCGATATCACTGCTGGATTCTTGCTATGCAAGAACGTGATGAC
GGTCCCAACGATGTCTTCTTTCAGTGCTGGTGCAAAAATTTCCAGATATTCTCCCATCGATCCCAGACAATCCAGAGTGTACAGCAACTCGAGCATTACC
AGACGCTTGAAGTCCTCTTCATGATGCTCAGGACGCGGCATCACGACCGACCCGTCTTCAAATCCACCCAACACGTCTTCATCGCCACCGGAAATTGGCA
ATGACTGCTGTATCGGAACGGCCACCGCCGGCTCCTCCTCTTCTTCCGCATCCATGCTTGCTGTAGCATCCGTACCTTCGCCATGCTCGTTGCCATGTGC
TGGTGCCCGACTGCCAATATCCGAGTGCTTCCTCTTCAGCGATCTCTGCGGTGTTGTTGCTTTTGTCGACGTGTTGCCTCCACCACCTGTAGTTTTCTTA
TGACGAGACGAAGCCAGACGCAAGTGGTCCTGGATATACTTGACCGCTTGCTGCCGCTCCTTCTCCAACTTGGACGCGTACATCCTGGCCCTCTTCAACA
ATTTAACCGGCGTGTCATTATTCACCACCGTGTCCGCAACCGAGCGGTCTCTCAACCCCACAGACAGCAACCCCGTCGCATAGCACCGCAGTCCTGGATC
GCTATCTGTAGCAAAGCCACACACTCGCTCCAACATCTCCTCATCGTCGTCCAGCATGCGCACGATCGCTCGGCTATTGACCGGCACCGTGGCCAGTAGC
AACCGACACGTCGCAGCCTTGACGCGGTTCAC