Description :
From Genome Similarity Track
Location :
Scaffold_2:383852- 385655
Transcript NameFunction/comments
Phyci_298110callose synthase, putative

Sequence
1803 bases(100 bases per row)
AGTGGCTGAAGGCGTAGAACCGGAATAACTCGGCGAATTTTTCGTGCTTAATCGTGAAACCACGACCCGTAGCGCGGTACTTGGCACCACCGTGAATCAG
AGTGCGGTCAAAGTAGTGCATACGCGTGCCCATCTGGAACGTGAAGAAAATCGGGCCAAGCGTCATGATGTTCCAGAGTAAATAGGTAAAACCATGTCGG
AAACCTTGCTCAACACCCACAACGGCAATGACTGGGACAACGAGCAAGAAGCCGAACTGGAACGCCCACGATGTGTTAAGCGTGCCGGCAATACCCAGAC
CACCCTTCTCAAGGAAGTAGCTGTCCATGCCACTCAGAGCCATGTACACCTTGCCGTAGATGAAGAAGTACACACCAACCACAGTCATCGACTGCGTGAA
GTACCAACCCAAGTTACCGTAGAACCACGAGTGCAGACGGAAGAAGTCCAGGCGAGAAGCCATTCGCATAGCATCGCGCGAAATTACAGCTTCGCCGGCA
CCAGACGATAGCTTCGCCTCGAACAGAGCAAGCTGCTGCATACCcacatcacgacccttacccacttgaataaactcctcgtgagacgtacgtccaccac
gaagggtactgttaaaaccggcgaaaatatcttcagaaaggttgacacccttggaggccttagcagtgccaccacagctcatggcaaacagcttgtcgaa
aatatcggggtgaccgtagtgcTGACGCACATGGAAAAGAGCAAGCATACGCTGACCCAGCGACACGAACGACAGTTCCTGAATCGACATGAAGCTGGCC
AAGTTCGACACGCCGCCCGTAAACACGTGCTCACGGAAACCAATAATCGTCAGCGGACGTTTCTCGGTGCCCCGGTCCATCGTTGACAGCAGGTTGGGCA
TCTTCAAGGCTTCCTCGAGGTAGCCGTCTTGGTTCATATCGATACACTGGAGCAGCTCACCGCGCGAGAAAATGATGGCGTGGTTCTGGTTCTCGGGCTT
ACCTTCGCCAATGACCGGGTTACCCGGCAGCTCCACACGGTAGATCTCGGCAATGTTTTCACCATCGGCACGCACTAAGACGGAGAAGAACTTCGGAGGG
CCCTCCTTCATCTTCTTGGGGCCGTCCACGTATGCAACACGGAGGGTTGGGTGCTTACGGAGCAGGTACTCAAGGTCAGAAGCCTGCTGCCGTTGCTCGT
CCTTCTGCTTACCATAAATCTGGCATGTGCACACGTAGTTGAATTTCAGAGCAACCATCTCGTTCAGGCGTTTGCACTTGTTGCACGGGCAACCAGGCTG
GTGCATGACCTCGTTTTCACAGATCTCCAGCCAGTGCAGGAAGCGAATGGCATCTTCGTTGTACATCATACCACGCACGGTACGTGCAAGCGTCTGACCA
CGGTAGCTAGCCCACAGCTGGACTTCCTCAGGGAACTTTTTCAGAGCCTCCTCCATATCCTTGGCCTGAAGCCGTTCGAGCAAGTTTTCCCACTCAAATG
GATAAATGGTCTTCAGGTAGTATATCAGCTTGATACTGTCATCGTTTTGGGCAGTCAAGTCCTTGATCGAGTACAGCACAATTTCGTTGTAATACGGAGT
CGACACCGTCAGCGAGCGGATCTTGCGGATTGGCTTGGCCTCGGGCATGTCCATAAACAAAGAGTTGGCGAAGAAGCGCAAGCGACGACGTCCTTCGTCC
GAGCGCGGCTCCGCATCGAAGTTATCCACAGTCAGCAGCTGATACGCGCGTGAAACAATGTCCAAGGCTGCCTCCGAGTTCACTAGGCGCTGCAGCTGCA
TGT