Description :
From Genome Similarity Track
Location :
Scaffold_155:3838- 5418
Transcript NameFunction/comments
Physo_143861hypothetical protein

Sequence
1580 bases(100 bases per row)
CCAGTCTTGCGGCCGGCGATCACGTCCATTAGCGTCGTCTTACCGGCACCAGTAGAGCCCATCAGCGCAGTGATCGAACCGGGGACAGCGTAGCCGTTGA
TGCCCTTGAGCAGCTCGAGTTGCTCCTTCGGGTTGTGAGGGTCCGGCACCCAGTAGTGCAAATCCTGGAATGCCACAGTCACCGGGATGAAGTTCTTCTC
ACGAGTCTCGACAGGTAGATCCACAATCACGTCGCCCTTCGAGTTTGCCGCCTTTGGAGTCTCCGTGAGGAAGTACGAGTTGTTCTCATCCTCGACAGGC
TTCACCGACACATCCACCGTTTCCGGTGTTTCGTAGCGGACGTACTCCATCGCCAGGTACGACAGGAACATCAAGAAGACGTACACGGCCAGTAAGTAGA
TGATGGCGTACGCGACCCACTCCTTCTCCGTGGCGATACCGAACAAATTCAGGTAGTACTCGCCCATGTTAAGACCGTCGTACTTGGCGCAGTAGTCCAC
GCCGTCGTACACGCACACGTCGAAGTCGCTGGAGCGGTACTGGTTGATGGCCAGCGCCTTGAGAGCCCACGCAATTGGGCTAATCCAATGCGCCCAGATG
AGGTAGTCGGGAATTTGGCTCTTGGTCACGATGAAGCCCGCGAAGATGATGAACACGAGGATCGAGACCATGCCCACCGGCATCACCACGTTGGCGTCGG
GCAGCGCTCCAGCGAGGAAGAAGAACCACATGCCCATGGCCAGGTTCGACACGAACAGTACGACCTCGAAGATGATGAACAGCTTCACATCGGACGCGAA
CCCGCAGACCCAATAGACGATCGACCCGAAGATGATGGTCTCGGCCAGCGCCAACGGGATCTGGCTCACAGTCGTCGCTAGAACGTAGGACCCCGTTCGG
AAAAAGTTGGCCCGGCGGTGCTTGTAGAAAATGTCTCGCCCAGCAATGTAGACCGGGATCATCGAGCCTTGGCCCATGGAGAGGAACATGACAGTGGCGA
AGATCACTCCCATGACCACGGAGATCTGCGTCGGGTCGAACTGGTAGAAGATGGAGCAGTAGATCAAGCCCATGATGATCACCATCATCAGTCGCCCCAT
GACGAACGCCTTGTTACGGTACGTGATGAGCAGCGCGCGCCACTGAAGCGCCAGCACACTGGCAAATACAGACTGGTGGAAAGTCGGCATGGGGTCGATG
ATGTCCTTCACACTCGCGACCAGCTTCGGGTCATACGGCGCCTCCAGTGCAGCCAGCGTGTTGCAGTAGATCCGAGACTGGCCGAAGCACTCCGCGAACT
CCCTCGGGCTGCGGGGCTGCTTGGTCGGGTGGGAAACCTCGTAGCGGTGCTGCTGCTTCGTACCCAGGTCCAGCAGGTAGTCGGCGATGTCGCGTCCCGG
GGGACACTTGAAGCCCAGCGTCTCGAAGTATTCCTCCACCTGACTGCAAGGTCCGTGGTACATGAGCTCGCCCTCGTTCAGGATCATGACGTCGTCGAAC
AGCGAAAACACCTCCGGGGACGGCTGCAGCAAGGCAATGACCACCGTCTTGCGGAGTCGGTGGGCCACACTGCGCTGCGT