Description :
From Genome Similarity Track
Location :
Scaffold_68:38376- 40805
Sequence
2429 bases(100 bases per row)
CTTTCTGCTTCTTCTATTTCGTCTACCTCGCACGCTTTCTCAGCGAGATTACCACAAGCGCGTCGTAGCTACTCGGTAAGTTCCACCTGGGAGTCCCTAC
GATCCTGCATGTAGTAATGCCAAACCTACCGTCTGGGCCTTTTCACGGTGGAGTGTCGCCACTGTCATCAGCGATGACCTTTCCTCGGACGCCCACTAGC
GTCAACCGGCTAAACCGAGTCAAAGGACGGCAAGGTGGCCTCGAGCAGCGTGTAATAAATATGTCGTCCCGACGAGACGATGAATAGCGTCGATGAGTTT
TTGCGGCTCAACAAAGGCAATGAGCGGAGTCGTGTCCGTGAGAAAGCTTGGAAGGATGGCGAGTGCGTATGAAGCGTGCGTTTGGGGCGTGGTTGCAGTG
GTTGCAGTGGTTGTGCGTGTGTGTATTTGCGATGGGTTTGTTATTTTGAGTGCGGTTTCATTGTTCAGCCTTCCCATATAGTCTAGGCGGTTAGGATAGC
TGGCTCTCACCCAGCAGACCCGGGTTCGAGTCCCGGTGTGGGAACATCTTTTGCTTTTCTTTCTATCTGCTTCTTCTGTTTCGTCTACCTTGCACGCTTT
CACAGCGAGATTACAACAAGCGCGTCGTAGTCACTCGGTTAGGTTAACGTCAAACCTACCGTCTGGGTCTTTTCACGGTGGAGTGTCGCCACTGTCATCA
GCGATGACCTTTCCTCGGACGCCCACTAGCGTCAACCGGCTGAACCGATCCAAAGGACGGCAAGGTGGCCTCGAGCAGCGTGTAATAAATATGTCGTCCC
GACGAGACGATGAATAGCGTCGATGAGTTTTTGCGGCTCAACAAAGGCAATGAGCGGAGTCGTGTCCGTGAGAAAGCTTGGAAGGATGGCGAGTGCGTAT
GAAGCGTGCGTTTGGGGCGTGGTTGCAGTGGTTGCAGTGGTTGTGCGTGTGTGTATTTGCGATGGGTTTGTTATTTTGAGTGCGGTTTCATTGTTCAGCC
TTCCCATATAGTCTAGGCGGTTAGGATAGCTGGCTCTCACCCAGCAGACCCGGGTTCGAGTCCCGGTGTGGGAACATCTTTTCCTTTTCTTTCTTTCTGC
TTCTTCTGTTTCGTCTACCTTGCACGCTTTCTCAGCGAGATTACAACAAGCGCGTCGTAGTCACTCGGTAAGTTTAATGTCAAACCTACCGTCTGGGCCT
TTTCACGGTGGAGTGTCGCCACTGTCATCAGCGATGACCTTTCCTCGGACGCCCACTAGCGTCAACTGGCTGAACCGAGCCAAAGGACGGCAAGGTGGCC
TCGAGCAGCGTGTAATAAATATGTCGTCCCGACGAGACGATGAATAGCGTCGATGACTTTTTGCGGCTCATCAAAGGCAATGAGCGGAGTCGTGTCCGTG
AGAGAGCTTGGAAGGATGGCGAGTGCGTATGAAGCGTGCGTTTGGGGCGTGGTTGCAGTGGTTGCAGTGGTTGTGCGTGTGTGTATTTGCGTTGGGTTTG
TTATTTTGAGTGCGGTTTCATTGTTCAGCCTTCCCATATAGTCTAGGCGGTTAGGATAGCTGGCTCTCACCCAGCAGACCCGGGTTCGAGTCCCGGTGTG
GGAACATCTTTTGCTTTTCTTTCTTTCTGCTTCTTCTGTTTCGTCTACCTTGCACGCTTTCACAGCGAGATTACAACAAGCGCGTCGTAGTCACTCGGTT
AGGTTAGCGTCAAACCTACCGTCTGGGCCTTTTCACGGTGGAGTGTCGCCACTGTCATCAGCAATGACCTTTCCTCGGACGCCCACTAGCGTCAACCGGC
TGAACCGAGCCAAAGGACGGCAAGGTGGCCTCGAGCAGCGTGTAATAAATATGTCTTCCCGACGAGACGACGAATAGCGTCGATGAGATTTTGCGGCTCA
GCAAAGGCAATGAGCGGAGTCGTATCCGTGAGAGCGCTTGGAAGGATGGCGAGTGCGTATGAAGCGTGCGTTCGGGGCGTGGTTGCAGTGGTTGTGCGTG
TGTGTATTTGCGTTGGGTTTGTTATTTTGAGTGCGGTTTCATTGTTCAGCCTTCCCATATAGTCTAGGCGGTTAGGATAGCTGGCTCTCACCCAGCAGAC
CCGGGTTCGAGTCCCGGTGTGGGAACATCTTTTGCTTTTCTTTCTTTCTGCTTCTTCTATTTCGTCTACCTTGCACGCTTTCTCAGCGAGATTAAAGCAA
GCGCGTCGTAGCTACTCGGTAAGTTTCGCCTGCGAGTCCTTACACTCCTGCATGTAGTAATGCCAAACCCACCGTCTGGGCCTTTTCACGGTGGAGTGTC
GCCACTGTCATCAGCAATGACCTTTTCTCGGACGCCCACTAGCGTCAACCGGCTGAACCGAGCCAAAGGGCGGCAAGGTGGCCTCGAGCAGCGTGTAATA
AATATGTCGTCCCGACGAGACGACGAATA