Description :
From Genome Similarity Track
Location :
Scaffold_252:38352- 40572
Transcript NameFunction/comments
g16139.t1hypothetical protein

Sequence
2220 bases(100 bases per row)
GCGCGTCGCGGGCTGGCATCCATGGGCCAGGGCCAGGCCTGGATCAACCCGGAGAACGTGCCGCCAGGCGAGAGTCTGCGCAAGTTCGGGCGCGACCTGA
CGGAGATTGCCGCGGCGGGCGATTTGGACCCCGTGATTGGCCGCGAGGACGCCATCCGCCGCGCTACGCAGATCCTGTCACGCCGCACCAAGAACAACCC
GATCCTGATTGGAGAGCCCGGCGTGGGTAAGACGGCGGTAGCGGAGGGATTGGCGCAGCGGATCGCGCTGGGAGAAGTGCCCGCCAGTCTTAAGGACAAG
AAGGTGGTGGCGCTGGATCTGGCGGCGCTCGTGGCCGGTGCCAAGTTCCGAGGAGAGTTCGAGGAGAGACTCAAGGCCGTGCTCAAGGACGTGGACGAGA
GTCAGGGCAAGGTCATCCTCTTCATTGACGAGCTGCACACGCTGGTGGGGGCCGGCGGCAATGAAGGGTCCACAGATGCAGCCAATATGCTCAAGCCGGC
GCTGGCCCGCGGTGCGCTGCACTGTATGGGCGCCACGACGTTGGACGAGTACAGGAAGTACATCGAGAAGGACGCAGCGCTGGCGAGACGTTTCCAGCCG
GTGCTGATATCGGAGCCGAGTGTGGAGGACACGGTGACGATCTTGCGCGGGTTGAAGGAGAAGTACGAGGTGCATCATGGTGTGCGCATCGCTGACAGTG
CGTTGGTGGCGGCCGCGACGCTCGCCGACAGGTACCTAACGGAACGCAAGATGCCTGATAAGGCCATTGACTTGATGGATGAGGCGGCGTCGCGGCTGCG
TCTGCAGCAGGAGAGCAAGCCCGAGCCAATTGAGAAGCTGGACAGGGAGATCATCCTGCGTCGTATCGAGATTGAGGCGCTGCGCAAGGAGACGGACTCT
GCGTCGAAGAAGCGCATGGCTGCGCTTGAGGAAGAGGTGAAGAAGGCGTCCGAGGAGCTGCGGGAGCTCATGGACGAATGGAATGAGGAGAAACACAAGC
TGGAGGAAATGCAGCAGGCCAAACGTCAACTGGAAGAGGCACGTCGGGACCTGGTGGCGGCGCAGAATGTCGGTAACTACGCGCGTGCGGGAGAGTTGAT
GCACTCGGTCATCCCGAAGCTGGAAATTGAGGTGGCGCACGAGGAGCAGGAAGAGGAACAAGCAAAGAAATCATCGACGAAGAGCAGGACTTCGCTTGGA
GACGCTGTGACGGCTGATCACGTGGCGGAGGTGGTAGCGCAGACTACAGGAATTCCCGCGTCGACTCTGATGGAAGGCGAGAAGCAGCGACTGCTAAAGA
TGGAGGATCACATCAACCAGCACGTGATCGGCCAGGAGGAGGCGGTCAAGGCTGTGAGCAACTGCGTGCGTCTTGCCCGCGCTGGTCTTCACGCTCACAA
CCGTCCTCTGGGCGTATTCATGTTCCTGGGCCCTACTGGCGTTGGAAAGACGGAACTGACCAAGTCTCTGTCGGAATTTTTATTCCAGACCCCGCAGGCA
CTGACGCGCATCGACATGTCCGAGTACATGGAGAAATTCAACGTCAGTCGTCTTGTTGGCGCCCCACCCGGCTACGTAGGGTATGAGTCAGGCGGTACTC
TGACGGAAGCTGTGCGTCGTCGCCCGTACCAGGTTGTCTTGTTTGATGAATTCGAGAAGGCTCACCGCGATGTGAGCAATATTCTACTGCAAGTGCTTGA
TGAAGGTCGCTTGACGGACTCACACGGACGTGTTGTTGACTTCCGGAACACAGTCATCATCCTCACAAGCAACCTGGGCTCGGAGATCCTCGCTGGTCTG
CCTGAGGGCGCTCCCAGTTCAATGGCGGAGGGCGATGTCATGAACATCGTGCGTTCCCACTACGCCCCCGAGTTTCTCAACCGTATCGACGAGCTCGTGC
TGTTTAACCGTCTGAAACGTGAGGATATCCACTCGATCGTGGACTTGCAGCTTCGTCAAGTGGACGGACTGCTGGAGGAGAAGGAGCTGGCTATGAAGGT
GTCGCCAGAGGCAGAAGACTGGCTGGCCGACGTCGGCTATAGTCCGCTCTACGGTGCTCGTCCACTCAAGCGTTTAATCCAGCAGCACGTGCTGAATCCG
ATGGCTATCAAGCTCCTCGAAGGCGCTGTTGCGCCGGGCCAAGCTCTACACGTCGATATGAACCCCAAGTACGAAGAAGAACTTGTCAAGAATGCGAGGA
GTGCGAAGCCGCTGTTGATC