Description :
From Genome Similarity Track
Location :
Scaffold_1011:3835- 12076
Transcript NameFunction/comments
Phyag_g9105hypothetical protein
Phyag_g9106hypothetical protein

Sequence
8241 bases(100 bases per row)
ATGTGGATCAAGCTGACccagacgctgcagtggatCTAGACGTGGCGAATCACTCCCCCGTAGATCCAGCCCAAGTGAATCCAGATCCCGCGGACCCAGT
TCCTGTGGATCCAGACCAGCTGAATCCAGCCACTGTAGATTCTACACCTATGGATCCAGCCGCCGCGGACCACGTGTGCTACCACGAGAGTGGCGACCTA
TATGCAGAAGATGTCGAAGGGGAGATGGCCGTGCTGCCAGAAATCACTCTGGCGGCAGACGAAGTGAAGATCGTGGATATCCAGGTCGGGGATCCAAGGG
CTACCCCAGAGGAGGTCGATAGGTTACGCCAGAGGATCTGGCGCTACCGACATCTCCTAATCGGCAAAGGAAATGCGTTGCCACCGGCGGCCAGAGGCGT
CGTGTGCGACATTGATGTGGGTGGTGCAAGACCAATCGCCCAGAGGGTACGAAAGGTGGCTCCACAGTTTCGCGAGAAGTTGTCGGATCTAATCAAGGGA
TTGCTGGGAGCCAAGATTATCCAGCATTCGACGTCTCCGTGGGCGTCGCCAGTGGTTGTGATCATCAAGAAGAATGGCGTGGATATACGTTTGTGTATTG
ATTATCGACTGGTTAACACTCTCACTCGACTGATGATCTACCCGATGCCGCTGATTAACGACCTGCTCGAGGATCTGGACAAGGTTCTATGGTACTGTTC
GCTGGATATGGCAAGTGGGTTTTGGGTGGTGACAATGACGGATCGAGCTCGTGCGATTTCGGCGTTTATCACTCCCTTTGGTCTTTTCGAGTGGAATCGG
ATGCCGTTTGGATTGAAGAATGCCCCGCAGATCTACCAACGATTAGTGGATAATGCGTTATACGGATTTACGCGGATCCCGCGATCTGATGACACTGGAG
AGACCGTGGATCCATTTGAGGCCGGAGAACCGGAGGGTCCAGGCAAGCCATCGGTACTAGGACGCAGATCCTACATCGACGATATCTTAGTGACCGGTGG
ATCTTGGGATCATCTGTGTGACCGGGTTGACGCTCTGCTGGAGGCGTGTGATAAGTGGAACCTGTCGATCAGCGTGACAAAGAGCTTCTGGGGGATGCGT
AAAGTGGATTATCTGGGTCATCGTGTGTCGATTGAATGGCTTGAGGCTAATCCAAAGGATCTACTCGCATTGACGGATCTACCGTTTCCAGGAACGCTTA
GATCCATGCAGTCATTTCTGGGTAGTCTGAATTATTACAGTCGCTTCATCGAAGATTACGCGATCTACGCTGCTGTACTCTACGAGCTGCGCGAGGCAGA
CTTCGctgcgatgcagaagaaagATAACCGCGAGCGGATCGCGACCTTCTTGCGAGACGATGTCAAGTCGGATCCAGATCTTCGGACCTTGGATCCAAAT
GCTGGAGATCCGAGATCCCCGGATCAGGGGATACCGGAGGCGAAGACTAATGATCCAGAGGAACCAGTATGTGGAGATGATGATCAACTTGGAGGCGCCA
CTCCTGTTAGCAAGGTGGAGTCGGATCACGTGGGATCGGAAGCATCAGACCTCAACCGCTCGGATCCTCAGAAGAGCATGAAACCTTTGGATCCAGGACC
AGGGTCGGCAGATCCTACTGGTGTAGATCAGCGTTGGATCCGTGCCTATAGGGCGTTCGGAAAACTCAAGGAAAAGATCACGATGACGCCCATCCTGCGT
CATTTTGATCCAGATCTTCAACCGGTGGTCGTTGTGTACGCAAGCGATTGGGcgatttctgctgctctagTACAGGAGCACGACAGAATCTACCACCCGG
TGACTTTCGCTAGCCGTACTCTGAAGTCGAACGAGCTTAACTACGGTGTGGTTGAGAAAGAAGTGCTCGCATTGTTGCGGATCTTGGATCTGAACTACAA
CATGTTGGTGGGTCGGCAGATCCGAGTCCTGACACGGCACTCCACGCTGGCATGGCTCTTCAGATCCGCGGGTCTTCAGGGACGACTAGGCCAGTGGGCG
GCTTTGCTATCACCATGGACATTCGAGATTGTTAAGTGCATCAAAGGTGAAGACGAGATCCTGGGGGCGATCGCGGCTAGCATCACTCCCAGATCCGAGG
TGGATAAGGCGCTCATTTCGATCGCACCCAAGAAGGAGCCACGCCGCCGGATCCAAGTCCCAATCCCAACTGTCGAATCTGACGAGGAACTTCACGTGGT
GAGCTTCGACGGGTCGGCACGTGTCAAGCGTGGTGGAGGCGCCTTCAGCGCGATCCTATGGAAATTGCCTGGGTGGACAGTGGTGAAAGCCAGATCCGGC
TACGCTGAGGGGTTGACTGTGAATGAAGCGGAGTACAACGGGCTGTTAATGGGTTTGGATCTGCTCGAAAATATGGATCATCAACGCCTCGTGATCTGCG
GAGACTCCAACTTGGTGATCCGCCAAGTGAGAGGAGAGATTGACTGCAAGGCCCTGGACCTGACGCTTTTGAGGCAGAAGGCTCTGGATCGGCTGCGAAT
CTGGCCAGACCACGAATTAGTACATGTGAAGCGCGATTGGAACGGCAGTGCAGACAGCTTGGCGAGCGCGGCACTTCGAAGACAAGACGGTGTGGAAGTC
ATGGAGTCTGAGTGGCAGGATCTTGTCACACTGAATCGACTCGACGAGATCCTGGTAATCAAATCTGAAGATCCAGTAGCCCGGGTTTCGACAATGACGA
CTAGGTCTGCTGGTAGATCTCGATCCAACCCGAAGATCCTACAAGAAGAGATTGTGAAGAACTTGCGGGTTGAGCGGATCCGGCAAGCACAAGACGAGGA
GACGTGGATCTCAGGCCTGAAGAAGTATCTGTTGGGTGAAGTGCGTGATCTGACCAAAGATGAAGCCAGATCCTTCAGCAATGTGGCCGCGGATTATGAG
GTGGATCTAAACGATTTGCTCTTCTACTGCCCACCTACGGCGAGGACAGATGCAGATCGGGATGGGTTGATGAGACTAGTCGCACCGGAAACGCTTCATC
GAGATATCTTGCATCATTACCATGCGAGTCTGGAAGGTGGGCACCAGGGGATCGGACGCACCTATCAGCGCATCCGAGATCACTTCCATTGGAGAGGCTT
ATTCCGATGTGTTCAGAAATACGTCGGAGAGTGTGTCGACTGCGAGACGGGCAAAGGACGACCGACGATCCGTGGAGAGTCACCAGGGAACATCCAAGCG
ACCTACCCGTTCCAGATCCTGGCTATGGATCACATCCCGTCGTTACCTAAATCTTACAAGGGCAACACGGAATTACTGATGTGGGTGGATCTGTTCTCTG
GGTATGTGATCGCGAAAGCTAGCTCATCTCGAACGGCCCAGACGATTGCAGAATCCTATGAAGAATGTGTCTTCCGAAGGTTTGGGGCGAGTGAGATGAT
CCGACATGACCGCGAGCCGGGATTTATGTCGGATTTCTTTCGTGCATTTAACAGGATCCTCGGTCAACGCCAGCGTGCTACTATGGCTTATCGTCCACAG
GCGAATGGAACAGCAGAACGCATGGTGCAGACGTCGACCCGAGCACTAAAGATGTTTGTCCAAGATCTGAATCAACGGGACTGGGACGAATACGCGGAGA
GGCTAACCTTCGCAATTAATACGGCTCATGATCGGATCCGTGGAGATACCCCGCATTATTTGGTGCATGGGTGGGATCCCAGATCCACATTGGAAGCTAC
GATCCCAGTCGGTAGTACTCGACGTCAAGATCGAGATCCACGCCGCTGGCGATACCAGATCCAACGGTATTACCAACAGGCGCGAGAGCAGGTCAATGCA
CGATTACGAGAGGCGATCTCGGATCGGGCTGACCGCCATAATGAAGATGTGCGCCCACACTTGATCGAGGTTGGATCCCGGGTGTGGCTGTACTTGGATC
GCGTGAAAGAAGGGTACGCCCGAAAACTTGCACATCTTTGGCATGGACCGTTCCGGATCGCAGAGAAGGTCAACGAATTCACGATGAAGCTCGAGATTGC
TGGCACTGGGTATCATATTTTCCCGGTAGTACATgtgtcgaagttgaagctggtaAAGGAGTTTCCGGATCGACCACGAATCCAGCTGACTGTGCCAGAA
GCAAACCGCTTCGATTTCGACGAGACCCTACTACCGGAAGATAGCTGGATTCCAGATCAAGAGGGCGATGAGTTCGAGGTGGAAAAGATCACAGGTATGC
GAAGTGGTAAGAAGACGAGATACGGTCGGATCTACCGTGAATTCCTTGTGCATTGGGGTGGCCATGACGAACCGAGTTGGGTTGATGAAGCGGATCTCAA
CTGTGGCGCGTTGCTGCACGAGTTTCTGCGGGATCGCGCGAACCATAACCGGTTCAGTGCGATGCAGTCTCACGAAGAACAGTGAGGCTGGGATCTGTTG
AAGTGAGCTGGTCACTTTGACAGAGGGTTGTGTGGAAGGGTCTGCAGGAAGGCTGTAGACTGGAGGAATGGGTTGTATGTTAATGAGTGTGCAAGGTGAA
ACACAGCTGGTGCCGAATCCACGTGAATCCAAGATGGAAGTTGGTGGATCTGAATCCACCAACAGGGAGCCAGACCCTGGATCCTAGGTTCAGTGGATCC
ATGATTGAGGTAAATCTGGATCGAACAACAATGAGACGGATCCTGGATCGGGAATCTGCGGACCCAAGACTGAGAGTTCTGGGTCTATGCTGTCTGCCGG
GAACGATGTGGACATCTTCGGATGTAGGCTCAGACCTGGAGGCGACAACATTAGGTGAGCGACGAGTACCTATGTCATTAAGCACAGCGAGAAGAACAGC
AGTCGAATGACACCAACACGAATGGGATACAAGAGATATGGATCGAGAGGGATTATTGATACGCAAGTGCCGATCAGACCAAAATAAAAATGCAGCTGCA
ACGGGGTCCAAGAACCCGAAGATCGGCATCAACGGTGAAGCAAGAAGGGAAGCCGGATCCAGAGGTGGATAGTGGATCCAGGCCTTACAGACTGGCTGGA
TCCTGGGCGCGTACATCGATAAACTTGCCGGCAAGTCGCGGGATCCGATGCGCGGGGTGTGCGTCAGGGTCGTCACGGCAGTGGTTGCGCCATGGATCTG
CGGTGTTACACTCATCAAGAGCCTCCAGTAAATCCGTGGGCTCTGGACGCTGGAGGTTGGGATCCGCCAGATTCGCTAAGCGCGAGGCAGATCCGGGATA
CCAAGTCACTCGATCCGTCTTCCGCGGGAagtgcaagaagaagagatcCAGCAGAATGTCCAGATCGCACCAACCCTCCTGCATAGCGTAAATCAAGGCC
ACCAGACACATTTTCCACCGACGTCCTGCGTGACCACGGCGGTTGATCCGACCTTTCCGATATGTGATGAACCAGGGGTTCTCGTCACACATAGCCTTCG
TGATCGGAAAGGAGTGGGTAGACTCCCAAAATGCCTGCTGATCACGCTCCTCGGCGCGTAAATATTGACAGAGGAAAGGGCCCAGACGCCCCCCAACATT
GGGATCGAAGCTCAGAGCCAGGCTGGAATTCTCCAAAACTTCCCACGGTCTAgtggcgtccagcgccttgacgTTTTCCTCGGTGAGTAGATCCATACGC
CATTGATGATCTAACAAAGAAGGCGCCGCGGTCTCTTCGTACGGGAAGATCCAGCCGGAGCGGAGCGGAAGAGCCGGGAACAAAGTGTCGATCACTAGGC
TCATCAATGTCAGGTTATTCAGTTTCTCCACCGTCCATGGCTCAACTTCGGCGATGGATCTGGGGCGGACAGTTTGGCGATCAGGGATGCACTCGTGATC
TGGGGCGAAGTGAGCGGCAGGAAGGAGATGGCGATCTCCCGGGGGTGGAGGCCGGTCTTCCGTGGATCCACGATGGGTGCGTCTGGAAGGGCGCGGAGCT
GGATCTGCGGGAGTCGAACTTGGCCGAGTCGGAGTTGAATCCTGATTGCCCCCACCGGATTCAACTTCTTGGTCGGGAAGGCCAGATCCACTCGTTTCCG
TAGATCCGATTGGATCACGACTTGGGCAAGGATCGCGTCGGCGGTGTGGTTCAGATCGCGACTGAGACAGAGCCACGCGGAAGTCTTGCGTGGAAACATT
GGCGACGACTTCTGCCTCTTCAGGATCATTTTCCCCGGTGGCATTATCGCGATCCTCCGGCTGCGAAGTGGGCGTTACCCTAGCCGGATCCACTTCAACG
GCGTCGTCATTGGTCTCGACGACTAAGACTTCGGTCGCCTTCGCGTCGagatcttcatcttcgtcggaCGATAGTCGACGTGAACGTTTGGATGGGCGGA
TCGGTCCCGAATCCGAGTCCGCAGAAGAAGGCCTGCTACGCGCACGCTTGGGATCCACGCGAGATGTGGCTGGAGGGACTTTGGCGGCTGGATCCAGATT
ACCAATAGGGCAATCAGATGAAGTTGGATCGGGATCTGCGGTCGTGGATCTTGGGATAGCTTCGGGGTCTGGATCCGGATCTTTCAATGCAGCTGCTACC
GCTGCTAAGCGACGCAAAGCACAGTCTCGCTCCTGCTCTCTAGCCCCACAGTCACGAGCTACGGAAACACGTGCTCTCTCCAGCTCGACGCACTTGGCTT
GGATTTTCTCAACTTGCTTTCCGACAGAGGAAGCAGTGCGATGGGCCACAGCCAGCTGGTCTCCTGTAAAACAGAGACGAGTGAGTTTGTGAGCTGTATG
ACTAAATCCATAGAGAAAGCACGTACGCAGACCCGAGATCTCCGCCTTGGCTCCGTCTTGCAGGTGAGTGAGGTTTTCAATCTCACTGTTCGTAGCCGCA
CGCTCCGATGCATAGGCCTTAATTCGCGGATCCGTAGCCTGCGTGGATCTGGATTGGGTGCTGGGGGTAGATCGGGCTAGTTTCTCAGCCAAGGCGTCGC
GTTCCTTCATGACCCGCCCCAGTTGACGATTACTTTGCGCCAAAGACTTGCAAGTAGCATCCAGGTTCTCGGCGAGTTCGTCGGCGCGGGTGGTCATCTT
GGATGCTTGGCTTTTCGCTGTCTTGAGTGGATCCGCTGTGATCTGCGGAGGTGTCTCCCTCACGGTCGGATCGCGCAGATCCAGCTGGTCACCGGTCTGA
GATCCAGCATCCACATGTAGGCGGGAAGGTGGCTTCCCTTGTATGGTTCGTTGGACGTCCCGAATCTTTCCCAACTCCTGGTCAGCTAGCCACAACTCGT
GTTCAGCTGTATCACGACCCCGATCCGACGACTTCACAAGTTCTTGTAGATCCGTGATCTCCCGCTCGGCCAAATCCTTCTCCCTCACCAAGTGAGCTTC
TGACTGTGAGACCAGATCTCGTTCCGCCAAGAGCTCGTCGACTAGATCTCGTAGTCTGTGAATTTCGAAGATTTGACCGTGGGCCCTGGTCGACCGTGAA
ACTAGATCCCGCTCTTCCAGAAGTCCGTCGACTTGGTTACGCAGCCAATAGATCTCGTTGTCTTGAGTTTGGATTTGCGCCCGTAGATCCCGAGTTGGAT
CCAGCGCAGCCGGatccagcgcagcagctccggccGTCAAAACTTGCAGCGTTGCAACTTTGTCctgcaatcgctgcagctcatccTTCTGACCGGCGTA
AAATTTCTCCAGCTGTCGAAGGTCGTGCGTGGATTTCAACAAATTCATCGTCGTGGCCGTCTGACGCTTGCGCACCTGATCCAAGGTGTTCTGCACGACC
TCTAGATCCCTGGTACGCCGGTTGACGCGGGTGATAAGCTTGTTCACGTATTGGAATAGATCGTCGCGGGATGTATCTGCAGGGGGCAAACGAAGTAACG
GATCGGCTTGATCTGTCgtgctggcactggcggGCGCAGGATCTGGATCTGGCAACGGGTTGGAAGCCGAGCTCGACTTGGCGCTATCTCTAGGCGCGTC
ACCGTTCTGGTGGGCCATGCTAGCCACACGAGGAGATAGTCCTGGTGTATGGGAAGGCGACGGGGCTCGGGTGTGCACGCAGTGATGCCGTCGGTCGGCA
CCAACTGACGCGCAGGAGGCggtcgtggagaagcaacttTTGGAATGAGGAGTGATGGGAATAGAGTCGGAATCAGAAGGTCACTGATTCGGGTGAGTGA
CTCGGGTCAGACCCTGGATCCCCGAAGTCGGCCGATCTTGGATCCAACATGCGGATCCTAGAAGTCAGCAGATCCTGGACCCAACTTGCAGATCCAAGAC
GACAGTGGATTCTGGATCCAACCTGTGGATCCAAGTTGTCC