Description :
From Genome Similarity Track
Location :
Scaffold_71:38347- 41276
Sequence
2929 bases(100 bases per row)
TCAGTCGGATCATGCGAGTACGACCCAGATGACCTGGACCTTAAAGAACCACTGGAGAGGATGGCTGATGCCTCACTGGGACAAACACTCAACTTGGTCC
CCCGCATCAAGCTCCCGGCGACCTCAAATCTCACCGGGTTTCATTGGAGAGATAAAGGCGAGGACCGATTACGCAGCTGGGTGACTACCGTAAAGAACAA
ATTCACGAGGGATCAATCAACAGACGGAAAAATGTATTGTTCTCGGGAAATTGCTGACCGGACCAGCGCAGAACCCTCCGACTAGGTATTTCCGTTCGAG
GTAATTGGAAGAAACTATTGCACGAATTTTAAATAAAGTTATGCGGGTTTGGGTATACTAGTCACCTTCCAGTACTACCATTCGAAGTAGAAGTCGGATG
AATCTTCGTTGGACTATCTATTCCGTATGAATGTGATTGGACTCAGGGCAAAGTTGACGATCAAAGATGGACTGCCCGAGATTCCAAAGGAACATGTAAA
GCACTATATCAAGACTTTGGACGACCCAGAGCTATCGGACCAGTTGACTATGTTACGTCTGACGGATGTAAAAGAACTGGAGGAAGTGCTGAAGGTGCGT
CAACAGACTAAGGCACGACGAGGCAATATACTATTTGGATCAATGGTACCTACCCCAACTGACCGACCAAGAGCGGTGAAACGCCGCTCTGTGCATGCAG
TTCGGACGACCCTAGAATATTCAAGCTCAGAGGGATACAGTATGAAAAACTCGGACAACGAAGGGGAGTTAAGGCGAGTCTATCTGATGGAAGCGGAAGT
GGACAAGGAACGAGGTGCGAGGATGCCGAGGATGCCGAGGGACCGACCTACCCGGGAGGTCGACCAGCATCGACACTAGGGCGGAGATCCAGGATCCCGT
ACTTCGTCGGCCGCACTCAACACGATATGTGCCACTGTGGCTCCACGAAGCATGGAGACTTGGGATGTTAGAAGCAAATCACCTGTGACCACTGTGGAAC
GAAAGGTCATCCATTGGACCGCTGTTTGTTCGAGTGCCGAGATTGTGATAGGCCATGATGTAGGAAAGTGCTATATAGAAGAGCTCTACAATTTAATTCG
TCAATGGTATTATCCAAGCAAGCACGCTGAAATGTTTCCGGAGAAGGTCAAGAAGATGATAAATTAAAACGCTTGCCAGGTTTTATCCTGGTACGAGCCG
AGCGTTCTAATTTCTGTGTCTTCGTATTTGTGTGAAGCAGCTCAAGAACGACATGGACACACCAGCTAATACGACTAAAAATTTATCGAAAATTGGAAAC
TACCCTGTGGTCCATGTTGATTTTCTTTGTGAGCCTAATGAATTTTCTCGAGAAAACGCAGTGATCGAGTTAGACTTATTGCCATCCGAATCCAGGGGGT
TCTGGACATACCATGCTCCTGCGAAGTAGTTTTGACAAGCTAAAGCCTCTAAGAAGATCAACAATTATCACGCAACTTGTGGTTTGATACTGGCGCCAAG
ATATCCATCCTAAATACCACCTTTGTTCGTAAGGTTGGCTGCCAATTTAACGAAAGCTAACGACAAGGGTGAAGTGACACGGGGAATCCGTATATACTTC
GGAAGTGCGAAATCATATTTAGATCACTGGTGTACATTTTTAGTGTATGGGTAGGCACTGTGGAAGACCAAGATGCCATCCGGGGTATGGACTTCATGGT
CCCAACTGGTATACGGTTAGACCTGGCGGACGGAAGACTCTGCGTCCCCGATGAAGTTCGAGTGCAATGATCCGGACGAAAGCCGATCTATGATAGCTGA
GTGTCAGACGTGAAATTGAATCAGTGCGCAGATAACTATTGGGGGGTTGTGGAAATACCCTAAAAATGTCCACCACGAACAGTAAAAATTGTGGGTTACG
CGAGGACGAGATAAGTTTGTGGTTTATGAAGGACCAAGTACTAATAGCGCAAGGGTTCGTCTCAAAAATATATGATGAGTGGCTAAACCTGGAATATGAA
GCCACCACCGATCAAGTCGACCAACAAATAGACCCGACGGAGGAAGATTATGGTCCGATCGTGGAACGACCATAGTACACGATCCCGTCGAGGCATTCTA
CAACGACCAAGGTTCCCAGTTCCAGTGGTAAACATGTAGCATCAACAGATGTCCAATGAGGAAATACAGTCGTAAGAAGGAAGAGCGCATCTACCGAAAG
CGACTTCTCAAGAAACGAATTATTTCCGAAGATATCCAGCCATCTAGAGCCACAGCCGACAAGGAGGAGGCCGGAATGATCAATGTACCACCTGCAGATT
CCAAGTGTGCACGTTTGGGATTGGAGATCTCTGGGCTGAAGAAATAGTCCAAGGATGGGAAATCATGCTGGAGGCAGACCCCTCTTCCAAAAATATTGAG
TTGAAGGACAAACAGATTCCTGATACGGATGGGAATACTCCCGAAGAAGTGGATCGGCTGCAACAGATAATATGAAAAACGACATCTGTTGATGAGGAAG
GGTAACAACACCCTATTGCCTGCTACCCGAGGGGCTCTATGTGACATCGATATAGCCGATTGCGCAGCGTGTACGGAAAGTGGCCTCTCAATTCAAGAAA
AAGTTATCCGACCTGATCAAGGTACCGCTATCTGCAAAGATTATCTAACCCTATACCTCTCCGTGGCCATCGTAATTATCGTAAAGAAGAATGGGGTTCA
AAACAAGAAGCGCATCGGCTACCGTTTATTAAATTAATCATCCCAACTCATGGCTTACCCTACGCCTCTAATAAACAAACTGTTGGAGGACATGGACAAG
GCATTGTGGTATTGACCCCTTGACATGGCAAGTGCTTCTGGTTTGTATTATGACCAAAAGGGCGAGACGGATATCGTCCTTTGGCACCCTTCTGGGACTA
TCTGAATGACTGCGAATGCCATTTGGGCT