Description :
From Genome Similarity Track
Location :
Scaffold_56:38341- 41771
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_56-snap-gene-0.44Esophageal cancer associated protein, partial

Sequence
3430 bases(100 bases per row)
TGGACGACGTCGCTAGGCAATCCTCCAGCACTTGAATTGCCTGCGTGGTAGTCGCGTTTAGGAGACGGCTTTGCTGCTTGCGGACCGTGGCAAAGTACAT
CACCAAGTACTCGCGCGTCGTCTCGTAATAGGTCTGGATCCACTGCGCCTGCTTGCAGGCATTGCGGTCTACGCTGATCGTGGACTTTGTTGCTGTAGAC
AGAATCTTCACCTTCTCGTAAAGAAACGTCATGCATTTGCGCACAAGCACAGCGCCGCAGCGGCTTCGTTTGCGGCGGCGACNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGGAAAAGGCATCCAAGCTGCTGCTGTCGAGAGTCATTGCTGGCGAACATTCGTCTTGGCCCAGCATCGGT
GTCACCTGGTTGACAAAGTCCAGCATCAACTCGATCTGACAAAGCTGCACCTCCACTGGTATCGTCTGTGTTGCTGACACCGCTCCCATCAAAGCGTTTG
TGTCGCTCTTCTCGTCGTCGCCGGGGACACGAATGTGATCCATGGCTTCGATTTCACGCACAATGTCCTCGATCGTGGCTGTGAAATGCAAGTGCACCTG
CTCCGAGAAGCTGTCGTCGCCGCCATAGAGAACGTCGTTCGAGTCCAATCCAGCGATTCGCTGCGGAAGCTGCTTCTGACCCCAAAGACCGTACAGCTGC
ATCAAAAACAGCAAGATACGCACACGGGACCGAGTCGCAGCGACTTGGACGCGCGGGATCGGTGACGAGGTCATCTTCTCCCATGCCATGCGCTCCAACA
CGGCTTTCCGCAGCCCATTGACGAAATAAAACGCATCGTCGTCCGTCAACGATGGCGCATACACCAAAACGCTCACGAGGTCTCCGATGGTGCGCACAAG
TCCATCTGACTCGCTTGTATGCGAGTCTGTGTCTTGAAGAAACTCGAGGTCATCGATCGCACCGCTATCCATCGTGCTACCTGCTGGCACCTGATGCTGG
TAGTAGAATTTACTTGGGTCGAGCTCGGTGATCTGGACGATCGCAGCTTTCAACAGAGCATCCATCTGCGGGAGGCAATTGTTGACTAGTGCGACTTTGG
CCGACAACGTCATGAGCTCCAGTTTACGGAACGGGTCCGAAATCGACGGGATCGTGATGTGCGCGTATGCCAAACACGACTTGATGAAGTTGCGGTGGTT
CTTGACTTTCTGGTCGTTGTGCATGCCAATGGCGGCTGCTGCCACCAACNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGTCGTGCTGCTCGCTTGTGAAC
CTGCATCGCCAGTGTGAGCACGTTCTTCGCGAGCGTTGTCTTGACGTGCTCGAGTTTGTAAAATGCGCTTCGACAGTCAATGAACAGCATCAGGAGCGCT
TCTTCCTCTTCTTCTTGCTGTTTCTCGTCGTAATGGGAAGCATCGTGTGTCCCTTGTGGAAATGCATACCCTAAGCGAGAGATAAACGCGCAGATGTCTC
GTGTGGCGTCGGCGCGTTCCGTCGTCGTGCTCAGCGAATCCAACGCATCGTGCACACGGCAGCAAATGACAAACAGTGTGTGTGCCACTGCAGCCTCTGG
CCCCACCACATGCAAGCGCATACTGCTGCCAGACGCCGTCGCATACTTGGCACTCTTGCGATCCAGACTCACGAACGCGCGAAGCACTTTCTTGGCGACG
CCGACACTCGACTCGCGCTTGAACATGCCCATCAAGCTCTACGTAAAAGTTAGAAAAAGCACAGACCGTTAGGCATTTGATCACAGTACAACACCACCAC
AAGTCGAAACTACGTACGAGGAATTCACTCGATGGGATGAGTTTCGTGAAAAACTCAAAGTGCTCTTGAGCGCCATACACGACATTTTCAATCAGCGCAC
CCATGAGGTTGTACACCTTGGGTGTCAGCTCATCTGGCGTCGCTGCATTCAGGTGACGCACGACGTCTTTTAGTAGAATGAGGGCTTCGCGATGCTAATG
TGTCAAAATAATAATCACACACGCAAAGGGAACGGCATACTACTTAGACAATTCTGTGTGAACAATGGCATGCACTTATACACAAACGTACCGAGAAATG
GGCGACGATGAGTTTCATGTATGCAGCCGCACACTCCATGTATTGCGCAATATCTTCCTGAGACGTGATCGACGTCCACGCGTCGTTCAAGAACTGCAGT
TTGCCTTCTTTCGACGTCGTCAGCGTGGGTGATGCGCTCAGTTGCAACGCCAGCAGACTGTACAAGTGGCATTTCGTGTACTGCGACGGCGTCGACAGTC
GCATGAGGTGCAGCATCACGAGTGGCCTCGACGCATAGAATTGTGCACCAAACGCCTCACAGATATGCTTGAGCACCATGGAATTGTCGGAATATTCGCG
ATAATGCGCCAGAATCGTGTCGAAGACCTCATGGTGGCAGTCACCCGCAGCGCATTTCATCAACCATTCGACTGCTGGTGAATGTAGCCCCAAGTACTCT
TCTTGCGTCATATTGTTGGTCTCGAGCCATTTCTCGAGTTTCGTTGCCTGGAACTGGTTGTACGAGAAGAAATAGTCGAACAGGCTGCTGAGCACCGCGG
TCTTATCGCTCGGCGGCAGCAACTCTGAGCCGCTCAGTGCCAAGTACACACGCGTGTACAGCGCCACCATGGGTTCCCCTACACCTCTGTGCACATATAT
GCATGTTAGCTTCGCACATCCTCATCATAATTGGTTGGGAAAAAAATGATCAAAAGCTTGCGTACTTGATCATGTTCGACAGTCGCGCGACAATTTGAGG
GTATTCGCCATCACACAGGAAGCGATAGCACTTGAGTAGCGCAATCTCAATGTAGCTAGTGGGGTCAAAAGAGAGAATACACACACGCGGTTAGATAAAT
AGTTCACAAAATGCATCACACGCAGAACGCTGCTGAACATCGTACATTCTTGGTAGCAGTTCGCGGATGCACGCGGTCTTGTAAAACCAGTTTCGACACG
TTTCCTTCGCGTGGATGTTGACGTCGCTGCTCACAAAGTTCTCCGACAACGGCGTCGGCAGCGGTTGCCCGTTTTCATTTTCAGATCCACGTGCTTTAAT
GCGCTCAAACACGAGGTTGCCAAATGTGTCGAGCAAGTCGCTGACGAGCACAAACACGCACGGGTACAACTGCGGCGAGCTCGTCGTGTCACCCAGGAGT
TTCACCGACTTGATCGCGATCCGCAGCGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCACGCCGCGACGAGTTCATTCTCCA
TGATGTGGATCTTTTCAACGTACTCGCTTTGCGACATCTCGACCGTGCGATCTTCTTTCTTGGCTGAGCTGCCACTTGAAGAAGGACGGCGCTCGAGCAT
CTCCAAGCGCTCGCGTGTCTTCTTGAGCAC