Description :
From Genome Similarity Track
Location :
scaffold_37:383398- 386012
Sequence
2614 bases(100 bases per row)
TAGACCACAAAAaactttgagccaagcagataATTCCTGATctcgacaagtgcatacttcatcgcgagTGATTCCtcatcgtggactgggtagctcttct
ccgcagccttgagctggcgagatccaaacgcgatcaaccgatctcgccctcggcgtctcggctgcttgcagcagtgcatagtcgatggcaaagtccgaag
cgtcacagacgacactaaaacgACGATCGGGCTTGTCAACGCTAgtgttggtgcatgaaggaggctgtctttgagtcaaaagcttcccgatgctcggtgt
tccaacacctttTCAAAGAAGATTCacaatggccgtgtcatttctgcgtatttCTTGCTGTACTTatgcaagtagctggcgaggacaagccacttgcgca
aatccATTTGGTTCTTCGCAGccagccagtctacaatggccttgaccttagcgggaaaCGCTTCCCGATAAGGTACCTTAAAagaaaatttcttctgcgc
TGACGAAGCACTTGTATGCATTTGCattcagcttattcgtgcgcatgcactcgagcaccgctcttaaatggacaatgtggttctcttcatccaccATCCt
ttcgtgctccgcacgactggacgaagattcgtcgaagtatgtctgtgcatatgccCGGAGGGGCTTGAACAACTgcgccacaagacgattaaatgttgct
ggtgcatttgacagcccttggggcattaccagccactcctagcacatgccgctcggaatacttaccgctgttagcggattatcactcgctctcatgagta
aatggtaatacccatcgaccaggttgagtgcactgtattttGTAGATTAACCATGTCGTTCTGGGGAGCATTCTTCTTAGGATTCGGTGTCTGCGTCAGA
ATGGTGACAGCGTCTAGCTTATTgcaagcgtgaacgatacgcaacATCCTGTACGGTTtccagacacaaaacgtgggtgtcggatGGGTAGACCatctct
cacgcaccattcctgcgtcggaCTTTGCGCGGTAGAAGGCGTacatgacgtcgcactgctccttggacagggaccattggcgtgttacgcagtatttggt
tcccggaaccaggttgaTCTACCTCGGtttggaggtaggaccgacgacgggtctttggaaatgacgtcttgaaattcctttaccaaagggtagtacggat
ccgagagatccttcaggatcgaagactcacttcgtgcgctcagcaccctcttggtggcctccagaacagcttcatccagaagcgacgacgagtttatatc
ctcgttcggtcgtacaatgaccacctcggctaagtTGCCCGCctttgccaaactcttcgaaggtcatctcgtccagctcaagtagAGCATCCATCGCAAG
GATAGCCTCGAGCGTGACATTGCtgccccccgtcataccgttggcgACGGGGtacagctgtgcgctatcatgTAAACACAtcttgggtcagggtcgacgc
ccggcgtcttgcagataagaTACGACATCGCTGTCGCCTCTCCACAGAGGTTGTACGTCGCGGCGAGACCATTGGGAACACgtactcagcgtcgtccagt
gtttgCCCCTGTAATGATTTTCAATGCCTCGGCGTTGTTTACGAGCCATGTCCTCGTGATGTCATTCTGATTTTCGATACTCATGATATGAAATGCCTAA
AAGACCCTTCCTTGCCAGAGTCGTTCTAATAATACACTCCAAGTGGTTATAGCAATTACTCACCAGGAAGAGTTCGATGATACTCCCAGTAGTTATAGCT
ACCAATCCTCAGGAAGAATTCGGTGGGCTTGTTTGCCGTCGTGGGCACGGGCGTTGTGAAAAAGAAAGGTTTTGTTGCTTCTGTTAAGCTGTTGATACAT
CGGTAAGACCTGGAATGACAACGTTGATTATGTTTCTAAGTCTTCGTCCCAGCGTTACCGTAATAATGCCAAATGAGTCGTGTACAATTTGGTATGTGAA
TTATGGAAGGCGAGGAGAGGAGAGCTCAAACTAGAAACATCACAGCGAGCTCGCAAACCGTTTATTGAAGCTTTGGTTTTTGAGGGGACTACCCTCGATC
GAGAATGTGGAGACACTACATTGTTACTATTGGGCTAATTCGACATCATTTCTGTACGAACAATATACAGATATTAGCTGCAACATCGATCTCCAACAGT
AGTAAGCGGCGTCATTTCAACATTGAGTTATGCAATAGCTCATGTCTTTTGTATAAGCTCAATTTACATATGTTAGTACATTTAGAAGCACAGATATTTG
TGACAACTTTAAATAAAATCTCTCGAGGCCAATACTGAGGTTATAGAGCTTAGCAATAGCAACAAAAAATCCATTTAACAGGGGTTCTGCTAGATATTGG
TTGGATGGGTGTTAGATAAATAGTTCTCTTTCAGACAACGTCTTGTTACTGCCATTTTTTTACGATCCTGAATATCTCTTGGCACAAAGCCGACTTTTCC
TCAGATAAAGTTTCTAATAATTAAATATAGAAGAAGAAATAAAAGCAGAGTATAAATGATTTTTCCCTTTTCTGTACGAAAGTCGAGTACAATAAATATT
ACAGGTAGAAGGCC