Description :
From Genome Similarity Track
Location :
Scaffold_17:383355- 392700
Transcript NameFunction/comments
g4700.t1hypothetical protein
g4701.t1hypothetical protein

Sequence
9345 bases(100 bases per row)
GCGCGCGTCGGTGTGATGTCCCTCGTGAAGTAGCGCGCAGTGATTTCAGCATCGCAGCGTGATCGGAAGTTACTGCTGTCGCGCTCGTTGAAGTCCGATT
GCCCCGCCAGCGCTTCAGGGAGGCGTGGAGGGCTTTGCATGGTCGGCACCGTCATCTACGGATACCAGGAGTCTTCCTCATAAGTCAGGGTCCCTCTTGT
CCCGGCCAATTGCAGACGTGCTGGCAGCTGATGGTTCTCTTTGGCGTTGGACGTCTGGGATTTATGCGCAAGGCCGATGGAGGTGTCTTGGCGCCGATCT
CAGGTCACAGCTGCCTCGTCTTCGGCTTTCGGGTGCACGACCGTGACCAGCGACCGCTTCCCGTCGTTACTGCATCCACCTCGCGACCGACAGATGGCAG
CTTGTCAAGGACAAGATAATAGATCGCTCACCCGCGATGCACCATGCACCGGGTGACTCGACGACGACCCCAATGTGTCTGTGCAGGGCACATCGCTGAA
TTGCACGTACCATGCGTTTAGCCTTTCATGGAGGCACTTGAGTCTGCTCCCCTCTACCGAGCGGCCATTCACCAATTTACCTTGCTTCGCCAAGAAGCAT
CGTCCATTCCTTCAGCACGTGAGCTTGCTATCTCCCGACATCACTCACCCAGCGCCCTCCTCCTCGCACAATGAAGGTCGGTAAGATTGTCGCGTTCCTG
GTGCTCGCATCGCTGGCGGTGGGTTCTCTTGCGGACGCCTCCATGACAGCGAACAGACCCGTGGTGCGAAAGCTTGGCGGCGGCGGCGGTGCATCATCCA
CAACCACGACCTCCTCGCCTTCGAGCGACGACTCGTACACCACACAAACCAGCAGGTCCACGACGTTGTCTCCTTCCGGGGAGACGACTGCAAGTGCCAA
CCAGGGTGCAGACTCTACCGAGGCTCCTTGCGCGAGCACTGACTCGGACAACACCAACGACTGGACTGGAACCGTGACAGCCGCCGGAGAACAATCAAAC
TCCTGGGAGCAAACCAACACGAACCAGGGCGGTCAGTCGGCCAAAACCCCTTGCTCGGGCGACCAGAGCTCCACCGGCACGTGGGGTCAATCCACTGAGA
CCGCCACCAGCTCGACGGGTGCGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGGGCCAGTCAACGGAGACGACGACGAGCGGTGCCACTGGCGA
GCAGCAGCAGGGCCAGACGACCGAGACGGCTGTGTCGGGCTCCATTGGCGTGGACATCACGGCGCAGGGCGGCGAGTCGGCCGAAACCCCTTGCTCGGGC
GACCAGAGCTCCACCGGCACGTGGGGTCAATCCACTGAGACCGCCACCAGCTCGACGGGTGCGCAGCAGCAGCAGCAGCAGCAGCAGGGCCAGTCAACGG
AGACGACGACGAGCGGTGCCACTGGCGAGCAGCAGCAGGGCCAGACGACCGAGACGGCTGTGTCGGGCTCCATTGGCGTGGACATCACGGCGCAGGGCGG
CGAGTCGGCCGAAACCCCTTGCTCGGGCGACCAGAGCTCCACCGGCACGTGGGGTCAATCCACTGAGACCGCCACCAGCTCGACGGGTGCGCAGCAGCAG
CAGCAGCAGCAGCAGCAGGGCCAGTCAACGGAGACGACGACGAGCGGTGCCACTGGCGAGCAGCAGCAGGGCCAGACGACCGAGACGGCTGTGTCGGGCT
CCATTGGCGTGGACATCACGGCGCAGGGCGGCGAGTCGGCCGAAACCCCTTGCTCGGGCGACCAGAGCTCCACCGGCACGTGGGGTCAATCCACTGAGAC
CGCCACCAGCTCGACGGGTGCGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGGGCCAGTCAACGGAGACGACGACGAGCGGTGCCACTGGCGAGCAGCAG
CAGGGCCAGACGACCGAGACGGCTGTGTCGGGCTCCATTGGCGTGGACATCACGGCGCAGGGCGGCGAGTCGGCCGAAACCCCTTGCTCGGGCGACCAGA
GCTCCACCGGCACGTGGGGTCAATCCACTGAGACCGCCACCAGCTCGACGGGTGCGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGGGCCAGTC
AACGGAGACGACGACGAGCGGTGCCACTGGCGAGCAGCAGCAGGGCCAGACGACCGAGACGGCTGTGTCGGGCTCCATTGGCGTGGACATCACGGCGCAG
GGCGGCGAGTCGGCCGAAACCCCTTGCTCGGGCGACCAGAGCTCCACCGGCACGTGGGGTCAATCCACTGAGACCGCCACCAGCTCGACGGGTGCGCAGC
AGCAGCAGCAGCAGCAGCAGCAGCGGCAGCAGGGCCAGTCAACGGAGACGACGACGAGCGGTGCCACTGGCGAGCAGCAGCAGGGCCAGACGACCGAGAC
GGCTGTGTCGGGCTCCATTGGCGTGGACATCACGGCGCAGGGCGGCGAGTCGGCCGAAACCCCTTGCTCGGGCGACCAGAGCTCCACCGGCACGTGGGGT
CAATCCACTGAGACCGCCACCAGCTCGACGGGTGCGCAGCAGCAGCAGCAGCAGCAGCAGCAGGGCCAGTCAACGGAGACGACGACGAGCGGTGCCACTG
GCGAGCAGCAGCAGGGCCAGTCAACGGAGACGGCTGTGTCGGGCTCCATTGGCGTGGACATCACGGCGCAGGGCGGCGAGTCGGCCGAAACCCCTTGCTC
GGGCGACCAGAGCTCCACCGGCACGTGGGGTCAATCCACTGAGACCGCCACCAGCTCGACGGGTGCGCAGCAGCAGCAGCAGCAGCAGCAGGGCCAGTCA
ACGGAGACGACGACGAGCGGTGCCACTGGCGAGCAGCAGCAGGGCCAGACGACCGAGACGGCTGTGTCGGGCTCCATTGGCGTGGACATCACGGCGCAGG
GCGGCGAGTCGGCCGAAACCCCTTGCTCGGGCGACCAGAGCTCCACCGGCACGTGGGGTCAATCCACTGAGACCGCCACCAGCTCGACGGGTGCGCAGCA
GCAGCAGCAGCAGCAGCAGCAGCAGGCCAGTCAACGGAGACGACGACGAGCGGTGCCACTGGCGAGCAGCAGCAGGGCCAGACGACCGAGACGGCTGTGT
CGGGCTCCATTGGCGTGGACATCACGGCGCAGGGCGGCGAGTCGGCCGAAACCCCTTGCTCGGGCGACCAGAGCTCCACCGGCACGTGGGGTCAATCCAC
TGAGACCGCCACCAGCTCGACGGGTACGCAGCAGCAGGGCCAGACATATTTTGGCGTTTGGGGTCAGTCGAGTATCGGAACGAACGGGAGTACGAATACC
CAACAGCAGGGCAAAAGCTCGACAGGCACATTGGGTGTGACAACCCACGCGACTGTGTCTGGCTCAATCGGTGTACAGGGTGCCGAATCTGCTGGCATTC
CGTGCTCCAGCGACCATAGCTCGACGGGAACGACTTCGGCTTGGTCTACGCCGGATTACAAGCATGGTGTTGCATCTGGCACGGTCTCGTCCGTGACTTC
AAGTGCCACTGAAGCGCCCTTGACGTCGATCGCTTCGACCACGACTAGCACTACCAGATCTGGCAAGACTGGTGTGTCGACTACATCGGCGTCAGCCGCG
TCTTCGGCCACCTCGTCGGGGGATTCGTACGCAGACTCGAACACGCAGCAATCGGCCACTCAGTCCCGCCGTGCCCTTCGCCACTAAGGAATTTTCTCAT
CGGAAAAGGAGGGTTAGCTGCCAACGCGGAGCGGCGATTTGCATATCATGGCCTGTGGTTTTGTAGATTTCACTACTGCAGCCGTACCTAAATTGCACGT
TTGCATCGAAATTCGTCTTATCTTGTTATTTCTTCTTCTATCAAACGGTCTATCTAAGCAGTCTTAATTTTTTAACTTCAACATCAGCCAGTGGCAGTGC
CATGGAGCTTGCTGCCCGCTCTCAGCTTAGATCTTGCTCGAAAGAACTGCAATCACGTGGTCGACTTTTCTGTGTAGAGTAGAGTCAACGACGCAATACA
CACAAGCGCTGCCTGAAAGCTTCGCCACGATTAGCCGATGCTTTTGATCCTTGAGCGTAGCGTAAAGGCGCCAATATGATACTTTGAAGTATACCTATGT
ATAAACGGTAGAGATACTTACTCTACGGGGCGAGATACTAAATTGGGAATTGATGGTGCTGTAGCTATCTTCTCCATCGAGTACATGTAGGAAATCATCT
AGGTGTAGCGAATCTCCAACCTCGCAGCTTTGAATTGGTACGTGTGATCCTCACGTTGCAACTTGCAATCTTGACAGGCCTTCGAGTTCTATCGTGCATT
CGGACTGTTGCTCTAACCTCGGCGCACGTTGATTGATTACCATCAAGTGCGAACAGCGACGAGACCTTGAAGTTTTGATGCACCGGACAGCGCGGAGCTG
GACGCACAACGAACCTAAGTATGATACGTGTGCGCGGTGTACGTGTGATATCGCGACCGGAGACGATAAGCACGTTCTGTGCGTACCACAAAAATCATAG
CCATAGTACGCGCCTTTCGAACTCGCCAGCTGATGGACATGCGAATCCGGCTCCGACCGACACTGCATGCCACGCATGTATCCAGGTGACTATCGCGGAC
TTGTATCTCGGGAAAGGCGCTACAAGCCTCGGGAAGTCACCTTGGACGCTAAGCTGCTCAAGCCACGAGGTCTTCGAATCAAAGTCTCGTCTTCATGCTC
TCTCGGTGCAGGAGCTATCGCGCCATGTGGAGGCATCGCCATTACGCTATGCTCGACTATGAGGTTTGTCTCTTTTCTGAAGCTCAGCGGGCGATCACCG
GATGGGAGCACGACAAATCGGTCTGTTGGGTGTTCACCCTCGTGTGCCTCTAGACGGAGCTGTGGATACTCCGCATCTTGCTGCTCGAACAAGGCCCTTT
GTCGTGCTGTCCGAGAGTAGTTTGCGTCCACAGTCACTCACTTTTCAATTTACTTTGCTTCGGACAAGCATCGTTCTCCACACCCCAGCACTCACCGCTG
CTACCTCTTCACCCCTACCTCCTTCCTACTTCAAAGATGAACCTCACTAAGTTGGTTGCATACCTGGCCGTTGCGTCCTTGACCGTGGGCACCCTGGCCG
ATGCCTCCGTCCCCGCGGCTGGGCAAGCTGTTCGTCAGCTTGGAGCCGGGGGCGGTGTCTCGACTTCGACGACGGCCGATACGGCGACGCAGCAGTCCTC
GACCACCCAGACCGGTCAGACGTCCACAGATACGACTACCCAGAATGGCCAGACATCGACGAACAACGGAAACCAGGGTCAAACGTCTACGGTCAGCGGA
AACCAGGGCGGTCAGACCTGGACCCAGGGCGGCGGCAACTCGGGTAACCAGGGCGGTCAGTCGTGGGGCCAGGGCAACCAGGGCGGCGACTCGGCCACTA
CTCCGTGTCCCAGCGACAACACTAACCAGGGCGGTCAGGGCGGTCAGACCTGGACCCAGGGCGGCGGCAACTCGGGTAACCAGGGCGGTCAGTCGTGGGG
CCAGGGCAACCAGGGCAGGCGACTCGGCCACTACTCCGTGTCCCAGCGACAACACTAACCAGGGCGGTCAGGGCGGTCAGACCTGGACCCAGGGCGGCGG
CAACTCGGGTAACCAGGGCGGTCAGTCGTGGGGCCAGGGCAACCAGGGAGGCGACTCGGCCACTACTCCGTGTCCCAGCGACGACACTAACCAGGGCGGT
CAGGGCGGTCAGACCTGGACCCAGGGCGGCGGCAACTCGGGTAACCAGGGCGGTCAGTCGTGGGGCCAGGGCAACCAGGGCGGCGACTCGGCCACTACTC
CGTGTCCCAGCGACGACACTAACCAGGGCGGCCAGGGCGGTCAGACCTGGACCCAGGGCGGCGGCAACTCGGGTAACCAGGGTGGAAACTCGGCAGAAAC
TCCGTGCCCTGGTGGTGATAACGACTCGAACCAGTGGACTGGCACCGTAAGCACACCAACTCAAGGTTCTACTGGTGGTGACCAGACCCCTCCTGCGACT
ACGGGTGGTGACTCGGGCGAAACGCCGAATGGCCAGGGCTCTGCTGGTACGCCTACTACGGAAGCTCCGGCTACTGAGGCTCCCGCTACTGAGGCACCTG
TCACGGAGGCGCCAGCTACTGAGGCCCCTGCCACTGAGGCCCCAACAACCGAAGCCCCAGTTGCAACGACCAACGCGCCAGTGAGCAAGACTGGCATCAC
GACCACCACCCAGTCGGATGACTCGACCACCCAGCAGTCTGCCACTCAATCCCGCCTTCGCCACTAGGCGGCTATGGTAGCTTTTGGCCTCTCTGTCACA
GAGCCTGTGGCCTTGCCTGTAACCCCTGTTTCGTAAATACACGCCTGCTTCGCTTTGACGACAGAGCAGCTTGTCAAGCTTGATCGATTCGGCGATGGCC
TCTTTAGAACAGTCTCACCGTCACCGTGCAGTAACACACGTTGAATTTGATCGCAGCGGCTACTGCAACCTAAGGTCTTTCGTACACATACATGTACTGT
ACTCCTACTCTTGGTTGTGAACTATTGAATATGAATGATGAAGTTCTCGGGGTGCTGCGCATTGCTTCTATCGATGCAAGGGCCTCGGCATGATTCCAGC
GGATTTTTTCGTTTTGGCGGATTGGCCAATCCGCCGTTGCGTTTGCAGTACTGTGACTGCCCGATCGGTTGCCTTTGGGTGTCTTCTTGAGTTTTTATCA
TCGTGTAGACGTTTAGTAAAAAAAAAAAAAAGGGATACTGCAGCAAGCTTCTTGAACAAGCACACACCAAATTCTAGTTAATACTACTAAATTTCACGAT
GAAATTCTGCGGATAGCGGAGTGCTAGTTCTTGTACTGCACCACAGACAGCAGATTGATCAACCCGCAGGATGGAATTCGTCCGCTGGAAGGTGATTTCC
AATGGATTGAAACAGCGGAACTGCAGTACAGGCCTTAAGTTCTCCACCAGTAAAACTTTAGTGCATCGCTCTGCTGCGGTGCTCCTCAGACAAGCCACCT
CCGCAGGAAATTTCCTGGAGTCAATCATTTCCTTGAGTCAATCACGCATGCAATGGCTGCTACCGCAAAAAACAACCGCCTCAAATCCTGGAAACTGAAA
ACTCAAAGTGCCCCAGGGAAATCGACGCCCTGATTTCCCTTCGAATCAAAATGTGGCTGGTATCATCGTAAATAGAAATCCTCAGCTTAAATTGCCGTAG
TTTGTCGTCCGAGGTAGAAAATGCGATTTACCTCGGCTTCTGCCTGTCGCAACCCCTAACCTTTTCCAAGGTCATACAAAAAGGTGATACCGCCGCAATC
TACACTTGCGGATACTGCATCCCTGTTATAGAGACAACCTTCCGTTTTGCCGCTTTTGAACGGTATAAATGAGTGGCATACTAGCTTCAGCCCGCCACCA
ACACTGCACAACTGCTCCAAGATAGAGTGACCTATCCCTATTGAAGGCCCGAATTGTAAAACGGGCCCCTCCGAGATGCGGAGCTATACCAGGCGGCAAA
GAGGTTGAAAAGCACTATGCCGCAAGCCTAGCGGCTGGGCACATCTTCAAGAGCCCAGTCCGGCTCTGTTGTGCTGTTCGTGAGTCAGGAATGGCCGTCG
CCCTCACTCCCCAATTTACTTTGCGAGCTGTGTCTTTTTCCGAGATGAACCCCATCAAGCTCCTCACGCCGCTACTCGTCATGGAGCTAGCTGTTGTCTT
CGTCGCAGCAACCCCCGGCGCAACCCCCACCCCTGTGAATGGTCCGATTTACTACGGCCGTCCCAACAACGGTGGCTATCCCTACACTACTCCTCCGCCA
GTCGCCACGAAGCTCAGCAAAAATGAGACTGAGACGCCCACCCCCGTGAATGGTCCGATTTACTACGGCCGTCCCAACAACGGTGGCTATCCCTACACTA
CTCCTCCGCCAGTCGCCACGAAGCCCAGCAAAAATGAGACTGAGACGCCCACCCCCGTGAATGGTCCGATTTACTACGGCCGTCCCAACAACGGTGGCTA
TCCCTACACTACTCCTCCACCAGTCGCCACGAAGCCCAGTAAAAATGAGACTGAGACGCCCACCCCCGTGAATGGTCCGATTTACTACGGCCGTCCCAAC
AACGGTGGCTATCCCTACACTGCACCAACGCCGCAGACCATCAAAGAAAATTAAACGTCGTCGTGCAAGACCCAGCTAGATGCAGGCTTCATACCTGGGC
TCGAGGGTAATTCAGACACCCGCAGAGTTCACATGAGGGACGGGTATTGATGCTTTACTAACGTTTGGTGATGACTACATATAGAACGGGCATAGGAAGT
CGCTAAGTGACATCAATGTACCTCACTGAAAAACTAAAACGATGCTTTACTGAAAATCACGTTTAGCCACAAAAGTGGTTGGGTCTCGAACTGGTGCCGT
AGCCGATCACGAAGTTCATTGTCCGTAGGATTTCTAGCTCTGGCTCTGACGTTTGACGCAATTTCTGGCTGAATCAGGCGTAACGCATTCCAATTCGTTA
TTCTCCTCACCCCCCCCCCTATTATTCTACTGGGCTGCACACCTCGATCACATTGTGATACCTACTCTAAGCCCTACCAGGCGATGCACACCGCGAGTAG
ATGCCTTGAGGGCGCACACAGTTTATTTAATTTTGGATTAAAGTAATGCGACCAAGTAGCAAGGCAATCCTGGTAATGTACTTGGCCACCTGCGGCTAGG
AATTCGCAATCCTGTCTGTTGACCAGATTGTGCTACAAATTACATCGGCGGTCGGGAAGACTGGAGGTTACGTGTATTAAAATAGCAATGCGGAAGCTTT
CGGAAATGCTAGCAGCCGATTGTTAATCCTGAAATAAACTACCGCTGCTATTAGTACTAAAATCAATATTGGCATCGACTGTCGGTTTGCTCGAACAATT
TCAGCACAATTATGACACCGTACGAGCTGATGTTGTGCAGTTCATTCATTGGTATTGTTACAATATTGATTAGGAAGGCTTCCTCGAGCAAACTTTTAAC
AATGATTATTGTCCGAGCCCTCCTATGCCAGGTTGTGACGGAAAACCTGTCGGGTCCATTGAATGACGGTTCGCTCGAGTACGCATATACGAGGCTACCC
TTTGACTGTGACGTGTGCAGCTTGTGGTATGGTTCATGGTGGAGTCTGTCCTGGTGCCTCTCCGCATTATCTCTGGAGACGGGTACCTAAAGTAGAAGAA
GAAAAAACTTGTTGGGGAGCGTCCAGTCGATGCTGGAGAGCTTGACCCACTCCACAGTGTCGCCCATGATCTTATCGCCGTCGTGCACTGCCATGGCCTT
GATCGTCTGCCCGTCTGAGTCGCCATGGGATATGCCGTGCGTGAA