Description :
From Genome Similarity Track
Location :
contig_53:38335- 39682
Transcript NameFunction/comments
g10310.t1RAW26343.1 hypothetical protein PC110_g17245 [Phytophthora cactorum
g10311.t1POM64458.1 Hypothetical protein PHPALM_20003 [Phytophthora palmivora var. palmivora

Sequence
1347 bases(100 bases per row)
AACGCTAAAAAGCGCAAGAAACTCAAAGGCCGAACGCCCAGTCATGTAGCAAAGAGGGTCAGCAATTGGCAGTAGTGGAATTGTAGTGTTTTAGAGCTTC
TAGCGCTGATTTAGTGTTGTTTTGTTGCTGCGTAGGAGGAAAAGAAGCTTTTACTGAAGGAACTGGCGTTCCTGGAAGCCAAGGCAGCTCTGCTACGTCA
AGAGGCAGGGATTCCAGACCCGAAGGAGGTGGCGGCTACAGAGCAACAGGTTGAGATGAACCGACAATTGAGAGAGACAATTGCACTCCAGCAGAACGCT
GTGGCGGCTGTCCAGTCGGCGTCCACAGAGTTTTCGGTGAGTTGGTGCACAATTTTGAAGTGTTTGTGGTTGTTAATGATGAGGACGTCGATGGTTCAGA
CACTGCGAGGGCACAACCCGCTGCAAAGCTACATCCATTTGGGTACAGATACGGATGCGCGGCGATCGGAGGTCTGTGCACTCAAGCACGAGCATTTGCA
GCGGGCGAAGGAGTTTCTGAAGCAGAGGATGCAGCTGGTGACAAACCCGAACCGACCTTTTCATGAGGAGTCTGGGCACTTGACGGATGAGGGGCATTAC
ATCGCAACGAAATTGGATGTGCACCGATTTGTAGGTGTGGAGAGTGTCAAGCAAGTGTTTGAAGCGATGCAGTTCTACTTCCTGAATTTGGAGATCACGA
CGACGGAGTTGGGGGCAGATCTGACGGTGCGAGAAGACTCGAATGACCTGGAAGCTTGTATCCTCAAGAACCCCATGCTGCACCATCGCCTAGTAACAAT
GCTCTCGAACGGGCCGTTAGTCGAGAAAAACGCGATCAAGTTTTTCCAGTACTTTGGCGACGATGGAGAAGAGGATGGTCCTTATGGTATTATGGCCGCT
GCTCCTGTTGACCAGGACGACTTGTACCCGTACAACTCGGCAGAGCGTCTTCGTAAGGATGTATCTGCAGCAATGAAGCTGTCATCGTTCACGCGGAAGA
AACAAGGTTATGGAGAAACAGCGGAAGATGAAATTGTGGTGGTGTTGACGAGATGGTTCCGGATCAAGTTGCACCACTCGGAACTGACATTTCCGCCGCA
TGTGCTGCAGGAGGTTCAACGCAGCGCCACATTGTTCACAGATCACATGGTTCACAGCATGAATCAGTCATTGTATGGTGTTCCGTGAATGCAAGAACTC
ATCAAAACTGCTTGCATGTTCGCGTCGTTAACTCGAATAACGTTATCTGCAATATTTCTACATCATATTTGATCCGTTCAAAAAGACAGCGACGGCCTTA
ACGGGACTCATAGATGACTCGGTGCATGCTCTGAACCATCGTGTCTG