Description :
From Genome Similarity Track
Location :
Scaffold_89:38334- 40824
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_89-fgenesh-gene-0.7Conserved gene of unknown function

Sequence
2490 bases(100 bases per row)
ACGTGCTCCGCGAGTGCCGAAGCCGCCTGGCAGTCCACGTGCTCGGTGCGCACGATCAACAACAAGGACTACATCCCGCTCTCTGGCATGGAATACTCGG
AGATCAACATTGACGAGACCGACATCGAGGCCACGTACAACGCCGCGCGGATCAACGCGCTCAAGCTGAGCGGCGCGGCAGGGAATGCGGCCATGGGCGG
CATGCGCAAGAAGACGACGTCGTGGTACCAGCAATCGCTCACGCGCTTCACGACGTATCTGTGCGTCATGTCGTCCGATGACGACGAGCTGGAGCGCTGC
GTCAACGCTTCCAGCTCGCACGCGGCGCGAGACATTGACGGGAACTGCATCGCGCTCACCGGCGACGACGCGTGCAGCGCCAAAGGCATGTGCGAGCGCG
AGAGCAACTGCAAGTGGGATGACCCGGTCGCGGGTGCCTCGACGCGCCGTGAGATCTTCACGAGTGCGAACGTCACGACGGCCAAGTCGTGGATGGAGAA
CGGGTACCCGAAGACCTTGGCGCCATTCGTCGCTCCGGGGATTGTGTTCGCCGTACTGACGGCCATCACCGCCGTCGGGTTCCTCATACTCCGGTGCGTC
TTCAATCAGTGCGGCGGTCGGAACCCGCGCGAAAAGGGCTACACGCGCTGCGACATCCTCGTGCCGAGCATCACGTTCACGGTGTGCTCGCTCGCGGTCT
TTATCTGCATGGTCGTGACGGCGGCGCAGAACACCAACATCACGGAAGGCGTCAACGGCGTGCTCTACTCGGTAAACACGACGCTGGAGAATGTCGAGAT
CTTCGCCAGCAACTTGGAAACCCCGCTGAAAAGCACGGTTGCTCAGCTTGCAAACGCCTCGACCACTGTGAACTCGAGCGTGCACGATCTCGAGTGGATC
GCGAAGGACGGCGCCACGCTTCGCCAGATGATTGCCGACTACAGCGCCATTTACTCGGCGCAGGGTCCGTTCCCGAACAAGACATGCGACAAGACGAGTT
TCGCGTGCATCTCATGCCCCAGCTCGGTGTGTGGCACTCCGCTGGTGTCGTTCGTCAACACCAGCACGAAGACGGCAACCAACACGACAAACTCGACAAA
CAACATCGTGCTCACGCTCCAGGACGCCTTCGTGAACCGAACCTCGGCCATTTCGACGACAGTCCGCACGGCACTGCTCGAGATCTCCAACATCAACAAC
ATGACGCAGAGCTCACAGGACGTGGTGGAGGTGATCAAGACGACCTTCAACGACTACTCGTTCTCGCGCAAGGCTCTCGTGCTGTCCGTCTTCTTCTTCG
GGATGCTTTCGTCAGTACTGGGCATCTTCGCCATCTTCAAGGGCGTGTGCACCAAGAACAGCATGTTCGTGCAGTTGCTGCACGTCAGCTGGCTGCTCAA
CGTGCTCGTATGCATCCTTGGGTTCGTGCTCTCGGCTTCTCTGCTCGCGGTAGGCGCCGTCTGGTACGACAGCTGCAAGTACCTGAACATCATGCACACA
GACATCTCGCCGTACGTGCCGACTCAGATGGGCTCGATCATCAACGCGTGCTTCAACGACACAAGTATCCTCACACCGCTCGGGCTCGACAGCGCGATCG
CCTTCTCGTGCGATCTGGACGACAACTACGCCGCACTCGAGGCCGCCGACTTCACAGCGCTCTCCACGCTTATCACCGAGTACGGTGAGAAGGTCTCGAA
CTTCGACTTGACCGACTTTGGCTTCGACGCGACACAGTCCCGCACGCTTCTGTCCCGATTCACCTCGGCGCTAAAGGAGGCGACTGGTTCGTCGACGACC
TTCACGCAGGAGAAGGTGCTGAGGCCGTGGGAGGCGTTCGGTGGTTCCTCGTCTCAGTATGACTGTACCGCGAAGAACTTGACGGACGACTCCATCCCGA
TTTGCTACATGGAAGGCACGTGCGCGTCAGTCTCCAACACCACTGACACGGTTGTGACCAAGTGCAAGACGGCGTACTCGAACGTGTACTACTACCTGCT
GGCATTCAGCAAGATCTCGTCCTCGTTGGACGAGATGCGCGAGGATCTTCTAGGCGACACTGGCATGTCGTTCTCGTCCGGGTGGGCGTACGACCTGTCG
ATCCGAGAGTTCGCTGCCACGTACGTGACGAAGCTCCAGGCCGTCAAGACGAACACGATCGACCCGCTGCTTGCGACCGGCGGCGACGTGCGCAACGTTC
TGCAGTCGATCGAGACGATGCGGTGCTCCGAGAGCTGCGGCTGGATCAACATCTCGTACAACGCCGTGTACGACTCGCTCTGCAACGACATCCTCGGCAC
GACGCTCGCCATCTCGCTCTGCGTCTTCTTCCTCTGCCTCTTCCTCATCCCCATGATCGTGACGGCCATCACGCTGCAGAAGCGGCTGCGCGGCGTCAAG
AAGGGCACGTACGAGCAGCTCGAGAAGCGCCTTCAGGAGCTCGAGACACGCAGCCGCGTCAAGGGCCAGGTCGGCGCGGGCGGTAAGGGC