Description :
From Genome Similarity Track
Location :
Scaffold_942:3833- 11296
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_942-snap-gene-0.7HEAT repeat containing 5A
Pytir_DAOMBR486maker-pir_contig_942-snap-gene-0.5Soluble NSF Attachment Protein (SNAP) Receptor (SNARE)

Sequence
7463 bases(100 bases per row)
CTTGTTAGCGACAAACTCTTGGAGAATACAACGGTGGACTCGATCGAAGCGCGGCTCAGCGCGACAACGGCATCCTGAATCTCGCCACGATCTTGAATGC
TGCGGTAGCATTGCGCGACAATGCCAATCGCGTGGACCACCTGGCTTCTGATCTTTTCGGTGGTGTGAAGAAGCACGATGCCCGTAGTCGCGTATCGCAC
CACTTCGCCAAAGTGGGCCGTACTGTTATGCACAATCTTGCTTGGATCGCACATCAGGCGGAAAGCTTCAGCGGGGCACAACGCTGCTTGGCCAATGAGC
GCATAGAAGCCTTGAATGTCTTCCTGGTTGTTCGTGAGTTGACTCTCACAGTACGCAATCGTCTCCTTCTTTAAACACGAGAAGAGCGCCTTCAAAGCCT
CTACTCGACTCGCTCCATAAGACCGCAGCGCAGCATTCACGAGCGCACTCACACTGCTCTGGTAGAGCCCTAAGAACTCGGATGGCGTTGAGGACCTCAA
AAGTTGCTGGCCCCCGCCTCCTCGTTGAGTTTCTTCTTGCTCTAAACTCTTCAGTAACAATGGCATCGTCTGAATCACTGGAACCAGTTGAGCATCACCT
TCCTGACGATCTCGAACGCCAGTGTTGAGGTGAAACACTGAGAACGCGAGCAGCATACTGGAAATACTTGGCGAATGTTCTCCGTTGTGGAAAGAACTCG
GCAAGTGAGCGCGGGCGTAGACGAGCGCGCTCAGAATGTTGGGCCAGTAGCGTTTGTATACCTCACGGAATTTCTCGGCGGAGCTGGAGGATGAGGCGTG
CGACTCTGTCGTTGGTACTGGGAGCAGCGTTTTCAAAACTTTCGAAATCGTTGCGCCACCGCCNNNNNNNNNNNNNNNNNNNNNNNNGGAACTCGCTTTC
GTCCTCGATGTGCGGCCACTGACCCGAGCCGCGCATAAGCACACCGTACGAGAGCGTCACATCCTTCCAGCAGTCGACCAGGTAACTCGAGTTCGACGCG
AATGTAGTGAGGAACACCTTCACAAGCGGCGACGACGCGACATTGCCGCCACTATTGTGTCTTTCACCTTGACTTTCAGCAACAGCTTGAGAGATGCTCG
ACACCAGCATCTGCGCGATGCACGAAAGGTTCGCGAGCGACAGCGTAACGCGCGTGACCTCATCACCAATGAACTGCGCGTGTCCGAAATCTTCAGCAGC
GACCATCTTGAGAATTCTCCCCAGCGCAACCTTGTCCTGAACCAAGCGAGAGGCAATCGAACCGCCACAGATTCCGTGTGCTTCAATCAGCAAAGGCGCA
TACAGATCCACGACTCCTTCACTACTGCTTGTGGACGACGACGACTGGGACTGGGACTGGGACTGCTTGAGAGCTTGGCGAATCGCAGACGTCATTTGAG
CTTGGTACGGGTCAAGCAAGAACGCGTCGCCAGTGGGAACTTCTGGGTCGCGAGCGGATGCAAACTTGTGCACCAAGACGTTCAAGAGCCGTAAGCCAAC
GCTTTGGAACATCTGGAGCTCGCTCCCATCGGCAGAGGCAGTTGCAGCGTGACATGCAAGCGTGACAAACTCGTCCAGGTACATGCACAGGAAGTTGTCC
CCTTTGTGTGATTCTGATTTCGCGTCAGTTTGACCCGCAGCGGTCGTTGCTATCATGCGGTCCGTCTCAAGTTGCTGCAGAAAGTGTTTCCGCGCGTCCA
CGAGATCGAAGTGCAGTGTCGAGTCTCGTCGGCCGCTCGTCGAAACAAGCTCAATCACTCGAAGCACACAGTCGACTGCAAAGTGACGCACTTGCCGAGA
GAGTGGTGGCAAAACTGCCATGAACTCACTCACGATTCTCTTTGTGTTGCGCCAGATCTCGAGTTGCGCAGCCATCGCATCGGACGACAGCAAGCTTTTG
TCACTGCTCTCAATAGCGCCAGGTTTTGGGAGTCCCCATCCTGACCCTTCTTCCACTGGACCGCCACTACTTGAGAAAGAGAGACCAGCGATGCCGTCGA
TCCCCTTTGGACTCATCATGAGCTGCTCCGAGTTCCCAGGACTAGAGGACGCCCCCGACTCGCCGACTGCGATGCTGCGACAGAAGAGCGACCAGACAAT
CAGCTGGTGTCCTTGGACATTGGCGCTGTCGATATCAACCAGTGACAGAATCGTATCGCGGATCTCTTGCGCTCCGCTTCGTGTCTTGCACGACATGAAC
ACCTTGAACGTCAGGTAGTCCCACATGCCATGCACTCCTGGCAGATACTGCCATGTCAAGCCATTGTATTCGACGTGGAGCGCGTGGAAAAGCAGACATT
GCAGATTCTGGCGCTGAATCTGTGACGGATCACGCTCGACGAGCGTTCGGATACACGACATGCCCACTTGCTGGAGAATGCTGCGCGCGATGCCGTTCAC
TCGAATGAGCACGTTCTGGCGATGCTGTTCACCCAACGATCCAAACGAAGACCCCGTCGAAGATGCTGAAGGCGATGGCTGCGGCGCATTGCCAGTCGGC
ACGCCGCCACCAGGCGTAAAGATGAACGCGTCGGACAACACGCCAAGGATGTACATGAGATTCATGTGCTGGAAACGAGTTGGCGCGAACACCACAACCT
GCTCCAGGAACTTCAGGTACTCGAGCTCGACGCGCAAGTCTCCATCTTGACGTAGCAAGTCCCAGATCGTGTAGAACTCCCGCAAGCGCTTCCCAGAGCT
CGACAAGTCTGGTCCTAAGGTTGCAACAACCCCGTTGATGATCCGTCCAATCGCGACGTTCGCACTGATGTGCCACCGCAGACCGCGCTTGTTCGTCTTC
GAGTACTTGAACCCTGCAAGGAGGTGCGCATCGATGAGCGACGACGTCGACTTGATGTACTGCTCGTAGTCACCACCAGTTGAGCCCACGGATTCGACGA
TAATGCTCCAGGAATGCAAGATCCAGGTCCTCAGCGGCTGGGAAATCTCGCCCGCGAACCTGAAAATGAGCCCAGTGTCGATCGAAATCCGGGATCCACA
CACTCGCTTGATGCAGGCGAGCGCAAAAGCCGCACCAGCAGAGAGAACCGACGCGTCGGCATCCGAGTTCCCACCGAACGGCGAGATCGAGTTGGAAAGC
GGCAGCTTCTCGGCGACCAGCCGCTTTTCGATCTCTTGGACCAGTAATTTGCAGTTTGGTTCGCTGATGAGCGACGCCAGCATACCGAGCGATTCGCCTG
CACTTCGTCGCACTTTTGCATTCTCACTCGAGATCATCTCACACAGCATCGTCTGCATCTGCTGCGGCCAGAAAGAGCTCGATGAAGGCGGACTCACATG
CGAATGCTTTGCTTCGCGAATCGCAGCGAACAGCAAAGACGACACGTTCACTTCACAGTCCACGCGACCGTCTGCGAGCAAGCCAGCGTAGTGCTGCAAG
CATCGCAGTTGTAGCTCTTCTGGGACAAAGTGGAAGATTCGCCCAAACAGGAACACGCTCGCGTCCACAAGTCGCACGTATGTGAAGCTGCTGCAAATCC
CTCGATCGTACACGTCATTTACACCTTCGATTTCGCACACGACACCCCAGAAGTTGTCCATGTACTGGACCTCCATTTCGGTATCCGAGAGCGCGTTTTC
GTGCTGAAGCAAAGCCAGGATGTGGTTCAATTCGCGAGAGTAGAGCACGCTTGGATTGTCTCCTGCAACGAGACGAGCCGTGCTNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGTCAACCCCTGAGAGCGCGTTATGCAAAAAAGTAGACTCCGCTGGAACCAGTGCGGACTGGCGCAGGCTGGTGAGCGACTGT
GCGACAGAGTACTCTGCGATGAGGTCCAGCAGCACGATGTACGAGTCGCTGAAAATCGGCGGCAGCAGCACAAACGACTTGATGAGCCACGTGATCACGC
GGTAGCGAGCAACTTGGCCTCGACGTTTCAGTGGATTGCTGAGGCGGTCTTGAGTCGCAGAGAGGAAGACGTTCAGGATGTACGCTGCAAGCATCTGCAC
GCTGTCCGACTTGGACGTCAGGTCTTTGCAGTAACTCAGAAATCCGTTCAGCGCGATCACGGCAGCCTCGATGCGCAGGAGCTCCAGCGACGACTCTCGC
GTGTGTAGCACACTCGACTTGAGCCAGAGATTCAGTAACTTCTGCACGCTCGTGTGGATCCAATGCTGGTCGTTCACTGCGACCAGGCTGCCCACGAGTG
TCCACCCCGCTCGTGTGCACGTCAGCCACACACTGTCAGTGCAGCCTTCAAGAAATTGACTCTCAATGAGCTGCTCAGCGAGTTGGAGGATGTCGGTGAG
CACAGTGTGCGAGAGTCCGCCGTCGTTCTGAAGCTTGATCGCTCTCAGGATGTGTGCAATCGCCGACGATCGTCCCTGGACAATGTACAGGTGAGCCAAG
CTCCTCAAGTTGGTCGATTCACCGTTTTGCAGTTCGTCTGCTCCTCCCCCAGACGTAGGCACGGGGTCTGCGGAGAAGCCTGTCTGCAACAGGTACTCGG
CAGTGACTCGGAGTCCGCTGATGCAGCTCGAAAGAACGGATTTCAACTTATATGGAAGCGCAGTCACCAGCGACGCAAGTGCCACGGCTGCCTGGAAGCG
AACACTCTGCTTCTCGTGCGACAGTAGTCCTTGCAGAGTCGCGGTTCCATCCTGCGCATGACTCACACATGCCTCGCCCATCGACTGCAGCATGTGGCTG
ATCTCGACCAAGATCGATAGCAACTTGTGGTGATGCCCTTCTCCTGCTGTTGCTGCCTCTTCCTTCAGCTTGTGGAGATACGATCCGAGCAGCGCCTCTT
GCTGTCTCTCTGTCAAGCACGGATACAGACCATAGCGGAGCACATAGCAGACTGCATTTCGCGCACGTGTCAGGTCTCCCAACGCGAACGGGTGATCGAG
AATATTGAGCGTCGCATCGATGATCTCACTAAACTGCTGCTCCGAGATCGTATCTGGCGGTAGGTGCTCGAACATGCTGCCGAGTGCAACCGAGTACGCT
GCAAGAATGCCTCCGTGACTCTGGTTTGGGTTCGATGTCGAGAGATATCGACTCGTCACGTTCTCTTTCAGGTACCCGATGATGCTCGCAACGGTTGAAA
AGTTGACGGCTGCTGCTTTGCGTCGCGATAGTGACCCCGGCAAGTTAAGGTGCGACATCCCAGAGAGATGCACGGTGGGCATCTTGAACGCCAATTTCGA
CTTTGTGCCGCCACCGCTGCTGCCGTTCTCCTGCTCGCCGGCGTGACGAGATGCGTCCTCGTCGTCATGAGTTCTACCAGATGCACCGCCTGCATCACTT
GCCGTCGTCTGCTGCTGTTGCTGTAAGTCATTCTCAGGCGTCGACGTTGCGAATTTCGCGAGCACGACGCCTACGACAGCCGAGTATGCGCGTCGAGCCT
CTGGTGCAGCGTCGTCCATACCCTTGATCGCAATGTACATGATCGCTTCTTGTGTCACACCTCCACTGCCGCCTGTGCCACTGTTGCTGCTGTTGCCACT
GCCAGCGCCGCCACCACTGCCACTGCTCGCACCGCTGCTACCATTCCCGCTATTGCCCAAGCTACTGCTGCTGCCGGTACCGCTTCCAGTGTTCCCTGAA
TGACTGTTCCCTGGACTCGTGTGCAGCGCCAAGATGTGCAGCAGACCAGCTGCCGCGAGACGCACTTCGGGGGTTTTCTCCTGAAACGTTTTGCTGACGA
TACGGAGTGCCTCTGGATGAAGCGCGACGACTCTCGGGAGCTCGTTGTCGAGCACGCGCGTGACGCTCTCGATGAGGCACTGCTTCATGAAGTAGTCGGC
GGTCTTGATGTTCTTGTTCGTAAACGTCACGATCTCCGACAGGAACGGGATCGCGTCGCTCAGCGGCAGCTTGCTCACGACCATCACGAGCGCCGTCTTC
ACGTAAATCGACGTGTTGTGCTTGGCCGTGAGCGTCTCGTTGATCACAGGCACGGCCGAGTAGTCGAACGCGCGCACGAGCAGGTCGCAGATCAGGCTCA
GGATGCACTCGGATGTCGACGGTACCGACGAGCCGAGCGACATGGTCATCGGTGTGCTAGCTCCACTGGCGCCGCTGCCAGAGTTCCCTGTGTGGTTGCC
GCTGTATACAAGCAGCGCCTGCAGCAAGAGCGCAAAGAGCTGTCCATTACCGCCTGATAACTTCCTGCCCGAGTTGGTCGCGGCGTCGCGGGTACTCGGC
GCGAGCAGTTCGGGGCTCCAGCGGCGCTCGATGGAGAAGAGCTCTTTCAGCAGCTTGCGCTGCTGGGCCTGCTGGTCAGCGGCGCTGCCGCCGGCGCGCA
GTTCCTCCACACAGGCGCTCAGGCGCTCGAACGCCATGCTCAGTCAGTCAATCGATCAATCAATCGCCGAAATGAATGAACTGACTAACGTACGTGGAAC
AAGGGAGGGGGCGGAAGTGGGGCGGGTTCAACAGCTCCGGGTCTACTTGGCAGGATTATATATTCTAACCCACCCATCCTATAGCTTGATTATATCTGCA
ACAAAATATGCAAAGGTTATGGGTCTGTGGGTTTTGGTCAATATGGGTATCTAAATAAACCCACTTACCCACCCATCTGAAAACACGTGAGCTTTCCTCT
GTCATTTTCAAGGCAAGACCCCAAAAGCAAGAGAAACCCAAGCGCAAGACAGAGAAACCGCGATGATGATGCAGTCTGGCGCGCAGTCCTGGGAGGACCT
GCGGCGAGCAGCGCGCACGGCCGAGCACCACCTGGAAGACAAGATTGCGGCGTACACTGCGATCAGCAAAGCTGCGGCGCGTGTGTCCACAGACTATGAC
GTCGGTGCGTTACGAGTGTGGTGCTTCTGTTTGGATATTGTGCATGGCGGATTGGGTTGGTGTGAACGTAGGATCTCACATGTATCTGTTGCCTCTGTTG
TTGTCATGACCATTAGAAAACCCACCTGCGGACACCACTGGGGAGCATGAGCTGGCGCTGGATATCGAAAACACACTTACAACGGTAAGAAGGGACTAAT
GTAATACAATGTGCCAGGTGTCTTGGACATGGGAAAGGAAGACAAGGTGCTGATCATTGTTTTGTTTTGACTTCTACATGCACACGCGAGCAGCTTTCCG
ACACAATCGACGAGATGAGCGCGTTTGTGAGCACGTCGTCTGTGAAAACGCACGAAGCGCTGCTGCAGCGATATCGCGAACTCTACTTTGATTTCAAGAC
CGAGTTTCGGCGCTCCATGGTATGTATGTTCATGTTCACATCCTATCTTTTCTTAGGCAGTGCATGGATACGGTATGGGTGTTCATTGATAGCTACTACT
TCGTATTGTTAACAGAGCGCTCTCCAAGAGAAACGCGATTCGCAAAAGCTGTTTGGAAACAGGTGAGCGAGTGTGGTGTGCTTTTGTCGAAATATGTGCA
TGTTGAAGTCGTCCATTCTGAGGTTGACCGATTTGTCCTCTCTCGCATCTCATGCAATACCAG