Description :
From Genome Similarity Track
Location :
Scaffold_311:3832- 6348
Sequence
2516 bases(100 bases per row)
CAACAGCTCTGTCTTTTGAGAACCTTGTTGGTGAAGCAAGGTTACTTTTTACCGCTCGGCGTCAAGTTCATTCTGAATGAACTTGGCGATGGTGGCGTGC
TGTCCGTCTGGCCCCAAAGCGGACAGCAGTGCGCCAACGGCTTCTTGCCCTATCGTTGAACTCAAGCGTTCGACAGTGTCCCATTCGATTTGACTCAAAT
GGGAGTAGCTCTCATGCGTGGGATGAAAATCATCCCCCTCATCGTCCAACACATTTATGGTCGTTGAACGAACTACGAAGTGCTACCAGGTGTAACAGGG
CACACCTTATTCAAGTAACTGAATAAACCTTGCACTGCTGACAGTGAAAGGGCGTGTGCTTCCGACTACCTCACGTACACGTACGTGCGGAGGAGATTGC
TATACGGAGTAAGAGTACTCAGTAAAGGTAAAAAGTAGAACTGTATTTAGTATAGTTAATCCTTGTAACAAATCCCTATTTGACTTCATTTAACTATGTC
TAAATACAAACATGTATTATAACTATCTGCGCGCCACTCGTTGCGTGCTTCTGTCGTGGCTAGACTTTATTGGTTGATATCTTGATCCTATATCAATCAA
TGAGCAGTGTGTTACATCCGCGGGGCAATATTATCTATTAGGATAATATTGTGACAATATTGTGTTTGTCCCAACGCAATATTCGTACTTGATGTTTACC
TTATGTAAATTATCATGCAACGGGGGCACCCCGTTACAAAAGTGCTCCAATGGCGCCCAAGATGACGCCTTTCCAGGAGCAGCATGCGCTGGTGTTCGGA
CTCGAGCTCATCAAGACGGAAATGGGCGGCGCGCAAACTGTGCGATGCGTGTTCTGCATCTATGACAGCCGTGACAGGTTGAGGTTGGAAGCTCAACTGG
TCGCAAGTGTAAGTCGCGCGTTGACATCAATACTACACGAAACCGTTCGCGCCGCAGAACTATCGCAGTCACGATGAGACCCAGCATAGCAAGTCCTGGG
CAGAGTAAAGCGAGCTGTATAACGCGGAGAAGCGCGAATACTTCACTGGGAAGACGGAGATCGTGAACACGTTGTATAACTATATTGAAGTTGAAGGCAA
CACTATGGAATTCAAAGTTCCGCCGCGAGACCATCATCGGCGACATGTTCTTCAGAAACGACGAAATGCTGGACGTCGAAGACGATGATGAAGACAACCT
CGTGGCGTCTGAAGCAGCAAAGGCAGTAGCCAAGAAAATCGCCAAGAATTCCAGCGAGAAGGCGCATGCGATGAAGCTGTTCGTCAAGGCCTCGGACAAT
GAGAAGTACATCATCACTATCAAGAATGTGATTCGTTACGAACTCGCATTGGACCACGTGGGAAGCGGCATGTCATTCAGGCAGGCGACCATGTCAATCG
AACACTCCAAGCGACGTACGCAAACGCCGAATCTCGCAGGCATTAACGGTTTGATGGTCGGCCAGTTCATTCACGCCCTTATCGCGTCAAACTTGTAACG
AATTGAGGACTTCATGGGTGACGCGTCCGTCTGGGCATTTTCTTTCGTGTGTGATGGCAGCACGCATCACGGCCAGTCGTTCTTTGATATGCGTTTGCGA
TTCTGCTACCGCGGCGTCCTGGTCAACTTGCACCTCGTCGCCATCCCAATGTTCGACAAGCATACATCGCAGATCACATTTGATACGTTCCGCAAGTTTA
TAGACGCGTTGTACGAATCGTGGTGTGGCAAATTGATTTGCGTCGCTTCAGAAGGCGAGAACGCAATGACTGGCCGCCATGCCGGCTTGGTCACTCGATT
GTGCGCTGCAGCTGAGCATCCTGTCCTTCGCATTTGGTGCGCGCCTCGTCAAAAATTGCTTTGGATTTGAAGCACTCGTCCGTGTGTTCCAAGGCGAATG
GATCGCCAAAGCGCATGCTTTCAGCGTCTTCCTGCGTGATTAGAACAGCTTGATCAACGAGATGAATGTCAAGTGCCCGAAGCTGACTACTCGCTGGGTC
CAGTATGGCATCGTGCTGATCGTTTTCATCATATACCGAAGAAGACTGGTCAACTACGGAGCTGATCATCAGAAGTTCGTCCGCCGTCGCCGTTCTGGTG
TATCATGACGTACGCTGCGTCTCCTGCCATTAGCAGTGTCAACAAGACAATTGTAGTACTGCAGGACAAGGCGCTCCTGATAGCGCAGCAGGACGAGCAC
ATTGTCAATTTAATTGGATCGCTTGTCGCGATGTTCAGCATTGACTCGACTGATGGGCCGATGGACGGCTATTTTGTTAACGGTGGCATACGCATCGCCT
ATGCGGACATTGTCGCTCACATCGAGGACCAGGGATCGTGGCCAACGCAGCTATTGGCGGCGCTGAGCAACGACGAGAAGGTAGATGTCTTACGCGAGGT
CACTACCTACGCGATGAACCTGGTGCTCGGCCTGCAGAGCGTGCGAGCAGAGCGCGACGCCAACAATCTGCCTCGCACGCAAGATCCACCGCCGGTAATG
CCTGCGCAGCTCGTCA