Description :
From Genome Similarity Track
Location :
Scaffold_232:38319- 41530
Transcript NameFunction/comments
Phymu_g7229hypothetical protein
Phymu_g7230hypothetical protein PHYSODRAFT_523131

Sequence
3211 bases(100 bases per row)
TTGTGCCGTGCCAcgtagtgctgctgccggGAACGGGAGAGCACGGATTTCTGCATCGGAGGACATCCATTGCCATCCCACTGGCAAAGCAAGGGGTTGC
CACACTGGTATGTTTGACATGAAGTTCCCGACCTTCGTTTTATTACTGCATTTTAGTCCTTGACGCTGGCTGTCACTATAGATTCTGGAAGGACCATTTT
ACGGGAAACGCAAACCACCACAGCAAAAAGGATCCAAGCTGCGAAGGTATAACCTATCAGGCTTGTTACGATGCTAGTAGAAGTAAAACTAAGGATTCTT
GTATGTGATCTGTGCCGTAGGGTAAGCGATCTGCCGATTTTGGGTCAAGCAACaatcgaagaagccaaaTCCCTGTTGGAACATTTCCGAGATCATCACG
GTTTCTCTCAACTAGTGGTCGCAGGCAGTAGCATGGGTGGGCTCCACGCTGCCATGGTTGCTTCAGTGTTTCCTGGTGATGTTGGCGCCACTGCTTGGTT
AGCTCCACCTTCCGCGGTTCCCGTATTTGCTGATGGGTTACTGTCCGGATCCTGCAACTGGCGCTCACTTtacaagcagcacgagctccagaTGTTGGAT
AAAATGCTGGCTGGGCATGCCGTGGCTGAATCCTATGAAAAACTTGCCGGTGCTGTTGCCGATAGTAAGGAAGagggagctggagctgctgaattGCAGA
TTGACCCAGTTCAAgagaccaagaagcggaTGAGACTATTTCTCTCGATCACAGATATCGACAACTTCTTGCCTCCGCGACGATCAGATGCGGTTGTTTT
CGTTTACGGCACTGAAGACGAGTACATTGGCTTCACAGAGCCACAGTGGCATGTACGTTGGGATCTAAGCTCACACCTCCATGGATTTACTAACCTTACG
CTGATTGCCAAATTCTTAGCGCATGCGCAAGCAGTGGGAGCCGGCGCACTTCCGTACAATCAAGACTGGACACGTTAGCGGCATTTTACTGGAACAAGAG
GCCTACCGCAAAACGATTCTGGAGGTCGTCGGACTGTTGAACGAGCAAGAAGCATCAACTGCGCCTACCTCGACGTCAAAATTGAAAGCATCAAGTGAGG
ATTAAGTACGCACGAAGTAGCTGCTGCGACTGAATGACAGGTCCAGAGCTAGATTAAAAGCTTGTACAATTTGTTTTAACGGAGATCTGTGAACATGTAT
TTCATCTTTTTTCACTCGTGAAGACAGCACACGATAATGTCCTGGTACGTGCTCATGACCGTACGAAGTTCTCCACGCGATAGATTCTCTCGCCACATGA
TCTCTTCGATGTGGTGTTCGCCGTGGAAATACACACACAGTCGCTTGAAAAGCGTAAAAACTGGATTGGGCTTGGCAATCTTAGCCAGATACGCACGCTC
TTGATCTGTAAACAGCAATTGGCTAGCGACGCTCATGACTTGCGCCATCGGCACTGTACTGCCTCCACGTGTGTCTGCAGCAGGATCCTCCTCCAATGTC
GCCTGGGGaggcgacggagctgcagctactggaTTCATGGGCGGAGTCTGCGCAATCGGCATACTTCCTGGTACACTGGTGTTCgtcgcactgctgctga
ctCGTTGTCGACGGAAACTGGACGCCATGAGAGCAGGAGAGGAACTTCCAACAGAGGACGCTCCTCCAGTAGCCAATTCTGCTGCGTAGTCTCCATCGGA
AGGGATCATAAAGTAAATGTAGCGATGGAGCTGCACAATAAAtcgttgctgaagcagcCAGATGAGCATGTGGATGTActcggtcttcttggccgtcGAT
AAGGTCTTCATGTACTCGCCAATACGGCGAGATCCTGAAAATGTAGACAAAACTTCGCCCAATTCGTAAGGTGCGAACTTGCGTCGGAATTCCTGCGCTA
GTCGAGAGTTAATGTGCAGATCAGCCTTTGCATTGACTTGATAAACGTTGTAGAGAGTAATTGCGTCCACGATCCGTCCGAATCCCCAATAGACGAGATG
TGCGGCCAGTCGAAAGACCTGGTGGATCGGTACTCCAGCCTCCAGTGCGATATCCTGGAAACTCTTCAATGGATTCACAGCTTCCACAAGATCTCGAAGT
TGACGTGCGTGGTCTGCAGGAAGCTTATTCAGGATATGGTCCTTGTCAGCTAGTAGCAGAAGCGTGTGGTACGGTCGCAAGCTCGCCATTCGGACTGTAA
CAGCGTCTGTGAGTGTCAATGATAGTTTCACCCACCCATTCAACACCACGTGCGCAGCTCCAGACTCCTCCAGGCCATGAAACACCCGCTTCAAGTCATT
TGCCAGCACACTCTTCCCCAACGAAACATCAATTAGGGTTTGTGGATCCACCTCCACCGCCGTCGATCCGTTCTCCCCGTCCTTCCTGTGATGGTGATGG
TGCATCATACTCGACCCACTCGTAGCAGCACTCGCTCCTGCATTGCTGGTAATGCTGCTACCACTCGTCGCTCcggctgcaactgctgcactCACACTGT
TTCCGCTCGTAGCACCGGAGATCCCAGTGTTGGTATTCCCAGCATTCCGCTCACTCTGAGCCAGTTCGTCcctcaactgcagcagttcccTCACTTCTTT
CGACACGAATCCCACGCGGAGTTCCTCGTGTAGCAGCCCATTGGACAATTGAGCAGCTACTGTATGGAACGCCTGCGCACTAGTCCGTCTTctggccaag
agctcctcttctccagcttgttgTAAAGGCAGCAACTGTGTATCAATGAACccatccagagcttcagcaggtCTTGTTACCTGTGGAGGACGGTCTTCCA
GAGCGAAAATGATGTTGAACATAGTCGTCTCGTTCCCTGTagtggcagcagaagcaTTCGTAGAGTGCTCTACAACTGTAGGTGATGCTCCTACAGCCGA
TGCAGAGCCGTTTGTCGCCGTAGGACCCGCTCCTGGGCCGTccgctggcgctgcagctggtaACCTACGAGATACAAGCACTGGGTGGCTCACGAAGCGC
AGATCGTCCACCACAAGCTCGAAACTGGCGTTGCAGAGCGCATTTTTGGGCCGGAAAAGCTTGGCTAaaagaggagctggaagcgagTGGAAGCTGGACA
CGTTCTCGCTCGGAGGAGCAGGGTATCGGAAGGCCAAGTTGCAGCCCTTGCTGATGTCGTCCACTACCAGCGCAACGCCCAAGAGGCGACACCCGCCGGC
GAGCCGGACGC