Description :
From Genome Similarity Track
Location :
Scaffold_272:38312- 39509
Transcript NameFunction/comments
Phyta_totarag6520hypothetical protein PHYSODRAFT_288740

Sequence
1197 bases(100 bases per row)
AGGGCAACGACGTTGTCACCGGGCTTCACCCAGCCGAACTGTTTGCCCAGATCCGTTGCGCGGAACAGGATCGAGTCCGTGCCAATCATGGAGCCCATGC
AGCGCGCGGTGACGCCCTTATTGAAGCCCTCAGCCTGGCGGGCAGTTCCACCTAGAGCCGTTAGCACCAGAACTGGCATCGAAGGGCGGAATTTAGACAC
CAGACGCGCCGTGTTGCCAGACTCCGTCAGCACCACGATCATCTTCGCGTTGATGTCGATGGCGGTCTTCACAGCCGACGACGTGATCGCCTCCTGCGTG
TCCATCTGACCGTACGTATCGAGCACCGAGTTGTGGAGAGCCTGGTACAGCTCGTTGTAGTGGATGGCGCCCTCAGCCTGCACGCAGATCTTGGACATCA
TCGCTACGGCCTCCGTAGGGTAGTCACCGTTGGCAGTTTCGCCCGAAAGCATGACAGCATCCGTACCGTCAAGCACAGCGTTGGCCACATCCGTGCACTC
AGCACGAGTCGGTCGAGGAGCCTTGATCATCGACTCCAGCATCTGCGTAGCCGTCACCACGGGCTTGCCGGCAATGTTGGCCTTGCGgatcatcatcttc
tgcgCAAGGAACACCTTTTCAGGTGGGATCTCCATGCCCAGGTCACCACGAGCCACCATGATGCCGTCCGTCTTGGCCAGGATCTCGTCAAAGTTCTCGA
GTCCTTCCTGACTCTCGATCTTGGCAATAATCTTGATGGCGCGGCCACGGGGGCCCAGTACCTCGCGGATGTTGTCAATATCCTGGCCCGTGCGCACGAA
CGACGCGGCAATGTAGTCCACGCCGTGCACCAGACCAAAGTTGACGAgatcgtcctcgtccttctccgtgAGGGTTGGGAGCATCACTTTGCACCCGGGC
AGGTTCATGTTCTTGCGCTCGCCCAGAGTCGCCGTGTTGTTGGCCCGGGTCACGACGCCATCTTCCTTGATCTCCGTGaccgtcagcaccagcgagcCAT
CGGCCACCAGAATGGATCCGCCGACCTGGACCGACTGGGGTAGCTCCGGATACGAGCAGGCGATCTTGGTCTCGTCGCCGAGGAACTCGTAGTCcgtcgt
gagctccagcgtggagcccttcttgatggtcaccttgtccttgttggACAAAAAGCCCGTGCGGATCTCCGGGCCCTTGGTGTCCAGCATGATGGCG