Description :
From Genome Similarity Track
Location :
Scaffold_81:38306- 39736
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_11305Hypothetical protein

Sequence
1430 bases(100 bases per row)
CCACATCTTGGCGGCCTGCGCGGTCGCGGGCGGCCTCGGCCCTCGCCTCGCGGAGCAACTTGCGAAAATCCATTGCCGACTGCGACAGGTAACCGGATGA
TTCCGGAAAAGGCTAAACACACCCAATTCTACGACGCCACTGGCGCGCACCGTCAGCGCTCCGAGCGATGCAGTCTGACATTGCAGGATATCGCGGGTCG
TGCAAGGCATCAACCGTCGTTATGTTGCTTTGAGGCTACTAGTATCGCGATGCACCCCGCTTCCCGGCTTGACTTCAAGCCTTGAAGCCAAGCCTTGCAC
CTTGAAGTTCAAGGTGCAAGCCCCAAAACCCTCTCATAATGCATATTTGGATTATACAATTCAAGAGGCTTTTTGATACAGGAAACTGCCAGTTTGAAAC
TTGGACCGGCCACCGCCAGACGCAAGACGATGGACAAATACCGCTGCATCAAGGAGATCGGCGTCGGCGTTCATGCTACCGTCAACCTCGCGGTCACCTT
GTCCTGCGACCACCTCGTCGCTCTCAAGATGATCCCTCTCTCAACGGCAGACCCTTGCTGCGTCCGTCGCGAGATCGAGTTGCCGATTCGCATCCGGCAC
GCGAACCTGATGAAGTTGTACGAAGCCTTCTTCACGGACGCTCACATCGTCCTCGTGACCGAGCTCTGTCCCAATGGCGACCTCGTGGCGTACACCAAGG
CCCGCGCGCCGCTGCCCCTCCCGGTCATCCAGAAGCTGGTCCGCCAGATCGCCACGGGTCTCGCCGCGCTCCATGCAGGCCGCGTGATTCACTGCGACAT
CAAGCCAGCGAACATCTTTCTCGACTACAACGTACAACCTCTCGCATGTGCTGCATGGGGCGAAGCTTGTGTGTTGTCGTACTAGGAGAACATCAAGATT
GGCGACTACGGCTACTGCATCGCGCGCATGAGAGACGAACGTCGCCGCAGACCCATCCGAGGCAACGCACGCTACCACGCTCCAGAGCTTATCCTTGATG
AGCCCTCTGACTTCAAGGTACGCATAAATGTGAACATCGTCGTCTCATTGGCTTTTTCTGCATGTAGATCGATGTCTGGGCGCTGGGCATTGTTTTCTGC
GAGCTTTTGGCTAATGCAGCCCATCTGCCGCACTTTGTCGTTCGCGGTGCGATCGACATTCCCGAGCACACGCCAGCGGCGCTGCACGACCTCATCGCCG
GCATGCTCGAACCCGAGCCGGAGCACCGCCTGTCGTCGGCCGAGGTCGCCGCCCACCCCACGCTCGCGTCTCTCTAAGTAGACTTAAACAACCGCACTGC
GTTTAGTCGTATCACCAACTAACTTTAACAAGCATTTCACTGGCATTCACAGAGCTGTCTCGCAACCATGTTCATTGTCGACTTCGTGTACCAAGGGAAG
GTCCGAAAGTGTGAACGTCAATTCTGCATC