Description :
From Genome Similarity Track
Location :
Scaffold_5897:383- 1396
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_5897-snap-gene-0.1Respiratory burst oxidase

Sequence
1013 bases(100 bases per row)
TCGAGCTCGGCCAGTTGGTCCATGAACTCGGTGAACCACGCGAGCGACTCATGTCCGTGCGTGACCCAGTAGAAGTATACCTTCTGAACCTGGAACTTGC
GTGGGAACGCCACGGCTTCGCAGCACGGACACTTGAACGATTCCCACTGGTGCACGATGCTTCGCAGGATCGACGCGAGTGGCGTAACGTCGTCCGGGCC
GGCGTTGACAAACACGACCGACTGGTACCGGTAGTACTCTTGCGACGGCGTCCCAATAGGCCCGTCGATACACACGGACGGGTACGGTGACTTCTGCGCC
GTATTCGCTTCCAGATCGACCGTCGCACTGTCTTGGCAATGATCTTTGATCGACTGGAGCATTTTGTGGAGATCGTCCGTCCACGCCGTGAGATTTCGTA
CGTGAACGCTGAGGTATTCGTCCTCGGGCGCCGATGAGATCGTGAACGGATGCCACTCAAGCCGCGAGATCACTGGCACGTTGAGCAGTAGGTACATGCC
CGGCTGGAAATCGAAATTCTTGGGTTTCTTCATGAAAATCGCGACTGTGTCGTGCGAAAACTCCACGCGCGTAATACTCGAGTGGCCACCAAAGAGCTTG
GCCATACGATACCGCTTCTCGACGACGTACAGCGCGAGTGGTGGCAGCACCCACATGAGCGCTTGCGGTGTTTGCACCCACATGGCCAGCCCATGGATGA
GGAGCAAGATGAGAAGCGACACGAAGAGCAAATGCGAGACCCAGAACGTGTTGAAGTGGCGGCGGTGGATCTTGGCGTGGGCGAGCGGTGCGGCGATGAT
GACGATCACCAGCATCACGCTACCTGTCCACATTGGAAGGTGCGAAAGGAGATCCCACAGTGTCTGATCCCGCACAAATCCGAGTGAAGTAAGCAGGTGA
GACTCGTGCCAGACTTCTTCTGGTGCAGTCTGGATGCGGTGCAGAATGACTCCCCACGCAAACATGTGGATAAGTGATGACACAAGCATGACGACGCCGC
AGATCTTGTGGAA