Description :
From Genome Similarity Track
Location :
contig_53:38296- 39643
Transcript NameFunction/comments
g10768.t1RAW26343.1 hypothetical protein PC110_g17245 [Phytophthora cactorum
g10769.t1RAW26346.1 hypothetical protein PC110_g17246 [Phytophthora cactorum

Sequence
1347 bases(100 bases per row)
AAGAGAGCGGTTCCACGTCGGACGAAGCGGCTCAAAAGCCCAATGTCAACGCTAAAAAGCGCAAGAAACTCAAAGGCCGAACGCCCAGTCATGTAGCAAA
GAGGGTCTGCAATTGGCAGTAGTGGAATTGTAGTGTTTTAGAGCTTCTAGCGCTGATTTAGTGTTGTTTTGTTGCTGCGTAGGAGGAAAAGAAGCTTTTA
CTGAAGGAGCTGGCGTTCCTGGAAGCCAAGGCGGCTCTGCTACGTCAAGAGGCAGGGATTCCGGACCCGAAGGAGGTGGCGGCTACAGAGCAACAGGTTG
AGATGAACCGACAATTGAGAGAGACAATTGCACTCCAGCAGAACGCTGTGGCGGCTGTCCAGTCGGCGTCCAAAGAGTTTTCGGTGAGTTGGTGCACAAT
TTTGAGGTGTTTGTGGTTGTTAATGATGAGGACGTCGATGGTTCAGACACTGCGAGGGCACAACCCGCTGCAAAGCTACATCCATTTGGGTACAGATACG
GATGCGCGGCGATCGGAGGTCTGTGCACTCAAGCACGAGCATTTGCAGCGGGCGAAGGAGTTTCTGAAGCAGAGGATGCAGCTGGTGACAAACCCGAACC
GACCTTTTCATGAGGAGTCTGGGCACTTGACGGATGAGGGGCATTACATCGCAACGAAATTGGATGTGCACCGATTTGTGGGTGTGGAGAGTGTCAAACA
AGTGTTTGAAGCGATGCAGTTCTACTTCCTGAATTTGGAGATCACGACGACGGAGTTGGGGGCAGATCTGACGGTGCGAGAAGACTCGAATGACCTGGAA
GCTTGTATCCTCAAGAACCCCATGCTGCACCATCGCCTAGTGACAATGCTCTCGAACGGGCCGTTGGTCGAGAAAAACGCGATCAAGTTTTTCCAGTACT
TTGGCGACGATGGAGAAGAGGATGGTCCTTATGGTATTATGGCCGCTGCTCCTGTTGACCAGGACGACTTGTACCCGTACAACTCGGCAGAGCGTCTTCG
TAAGGATGTATCCGCAGCAATGAAGCTGTCATCGTTCACGCGGAAGAAACAAGGTTATGGAGAAACAGCGGAAGATGAAATTGTGGTGGTGTTGACGAGA
TGGTTCCGGATCAAGTTGCACCACTCGGAACTGACATTTCCGCCGCATGTGCTGCAGGAGGTTCAACGCAGCGCCACATTGTTCACAGATCACATGGTTC
ACAGCATGAATCAGTCATTGTATGGTGTTCCGTGAATGCAAGAACTCGTCAAAACTGCTTGCATGTTCGCGTCGTTAACTCGAATAACGTTATCTGCAAT
ATTTCTACATCATATTTGATCCGTTCAAAAAGACAGCGACGGCCTTA