Description :
From Genome Similarity Track
Location :
Scaffold_31:38294- 40005
Transcript NameFunction/comments
Phyca_LT1534116653mar9 transposase putative

Sequence
1711 bases(100 bases per row)
agctacatttttggctgcagcaagcagttcactaccgcccctaagctccgcaaacgcattcgacagggccatggcatctactttaaccgccacgcaactg
gccccgcgcaacatggaaagaagaagctaaaaatgagcgagtactagtttgaagagaagcacgagcgtaatccttgctgctggtgattttttagtctggt
acttccgtcgatcagttaacccgttttgttttaagttactcattcatctattttctatacatttgtgctgtggtactcaaatccaatcaaacttcgagtt
tcccccggcttgcccgggtaggcaattaaaagcagtatcaactgctgatatcagtccatcgatttggtttgtaggttgccgatactgtatggactgaatc
gcgctgaaaattcccaaatctaagatgttgcagtcgggcgagcgaggaggttggcacatcatttgaatgttaaaaccaccttcttttccggcagcaacaa
cctcgccgtggtcctcgtcgacatgggggccagcgttgttttgctgaacccggataatagcttttctcgaacctacttatacaaaataaaaaaattagaa
tgtttagcgcatcagtaataaaaacatatataaaaaatcacctggccatttttgtcgaattgccggaaatactttttctcgaagcatacgtatacttctt
tcgacatgttgatgtttttcgtaattggagtcccggcggcacgattcttggatgttcttttggctctagcgcgctcgacaataggccaaattccaatttt
gccatcaaaaagtgtttttctcgaaaaatcgtagcgtggtctagccacggcagctataaacatcaccttgcatatgtaccttttgttcggacatgttcgg
tatggcaattccccatctgctgtcaggtagtaacgagaggaggccttgcacatgttgaaccacttctcatcaatatgtactacattgtacattgcatcaa
accggtacaaacaacaacctaaattaaatatcaataaataaatatgagtgaaataaatttaactaaaaaataaaaatacttaccaatggggcgatgtact
tgtgccagggcccatgtcagccgctgcagcttgtgtgtagctgtcagagacggcttaaccctcgaaatgaaacgtcgcagtgtgttcgccttcaggtatc
gatgcaacgtggatcgaggaatgccggacgcggcttcaagcgctcgcagcgtctgccgctgacacagtgggacggccgcaacgcgctcgccgatctcttt
ggggctgaggcgagtaggccgacgcgggtacggctttcggggtagcaccagggccgatggatcactgcgacgatcccagatgcctctgatagaggctcta
cttagtcgaaaaactttcttgcacgagtgatggtnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnn