Description :
From Genome Similarity Track
Location :
Scaffold_283:38291- 40903
Transcript NameFunction/comments
Phymu_g8051hypothetical protein
Phymu_g8052hypothetical protein

Sequence
2612 bases(100 bases per row)
gcGCTGGTTAAGCTCACTCTACAGCGAGCCAAGGCCACCAAGCGGCGGAATCGACACCGCCAACGCGTGAAACAGGAGTGGCAGACACTGAGATGCCAAG
ATTCCCAACTGAGCGcaaagctcgagcttttAAAGCAAACCCGAGTCAGTGACAGTGTGGGCGTGGGCCTCCTGAACTGgcaggcgctggcgtcgaAAGA
ATTAGACGCGCGGCtgcaagcagaagcgcaacgGGTTCGTATCCGAGCAGCGATTTCGTACCGAGCTGCTGTGATGCAGCACCTCCAAGAAATGCTCGAC
ACAGAGCAGACTCCGAAGAGCGCCAATATTTTGCCAGAATGGGGGCCAGACGATACAAAGTTGTACGGAAGCTTCCTGCTGGAGCTAGCTGTCGCTCACG
CGCGCACTGATGCTGTTTTTCACGACTGTGGACTGGCGGGAACAGTGCCAACCAACACGAGCTTTTACAAGCCACTGAGAAGACATGACGGTGTCCGAGA
GACGACCTTTTTCGAGAGCACGTCAGCATTTGTCATGCCCAACAAGTGCCCACATTCAGCCAACACCATGTTCGACGCAATGCGTCAAATTCATCGGCAA
CATCCTCGACGGAGACTGTTTGAGACCGGGGAGGATCGTTCGGACACGATCGCTATCAAGTTTGGCACAGTCTTTCACTGCGAAGGGGAGAATGTGGTTC
CTCTGTCGCTGATAACAGTGCTGCATCGGTTTGTGGAGATCGACCGAACAGTGTTGGTGTGGCGCTGTCTGGTGCAAGGAGAAGGGGAGTTCGCAGGCAC
GTTTCTCGACGAAACAGGCTGGTGCGTGCTACGACCAACGACGTCAGACTCACTAGAGGCAACGGATGTTCGAACGTGCATACACTCGATCCCCGTTCAT
CGAGGCGTCCACAGTGTTTGCGAAGCGGAAGACAGAGACGAAAAGTTTGCAGTCGCAGTGGTGCGTTCTGCACAACAGGACGCGCTACAACTCGTGCGTT
TGATGGATCAATTACTGCTAGAAGCTTGAGAGTAGAGGGTTTGCTGTCAATTTTGCCCTTCACGACATGCGAATGTACATGCAACTATGTTTTTCATTTG
AGTGAGGCCTTCCCTTATTTGTCGTACGTCTCCGAATGAACGATTCTGTCTAATCCTCGCTGCTCTGGCGCCAGGCGTCCACGAGCGACTTGAAGATACC
GTCAggcttgcgctgcagctcagcggGCGACCCGAACTCTGCCACCGAGCccttctccatcaccagGATACGGTCCGAGTCCAGGATCGTGTTGATACGG
TGCGCGATCGTCAGCGTAGTGCAGTCGCGGAACTCCTCGCGGATActttgctggatctggcggTCCGTCTCAGGATCGATCGACGCAGTGGCTTCGTCCA
TCAGAATCACGCGCGACCGCTTCAACAGCGCACGAGCAATGGACAGCAGCTGGCGCTCGCCCACGCTGAAGTTCGAGcccttctcgtccacgacgtcgtc
cagcgaggTGACAGCCTTGGTCAGCGACGCGCGCTTAACGGACGTCCAGATCTGGTCGTCCGAGAACTGGTCGAACGGGTCCAGGTTCGACCGCACAGTG
CCGGAGAACAGCACGGGGTCCTGCGGGATGATCGCGATGTTGGAGCGCAAGTCGTGCAGTCCGATCTTGCTGATGTCCACGCCGTCAATAGTAATGGAAC
ccgcgtccagctccacaagGCGCATCAGACCCACGATCAGACTGCTCTTACCGGCTCCAGTGCGACCGACAATGCCGATCTTTTCCTTCGCGTTCACGCT
GAAGGTCAAACCGCGAAGCACGCGTGGAAGACCGGGACGGTAGCGCAGGTCGAcgcggttgaagctgatAGCGCCAGCCGTAGGCCACTCTAAAGCCGGC
TTCTGGGCAGCCGTGCTCTCAAGCGCAGCTTCCACCGGCATCTCCGTGTATGTCTGGATACGTTCGATCGACACCATCTGCGTTTGAAGCTGACTGACCA
TGCGCACTGTCCAGTTAAGCGGCTGCGTAATAGTGAACGCGTACGTGAGCGAAACACCAACGATACCGGCAAAGGCGGTACCCTCGGCAGCGTTGGTACC
ATGAGCAAGGACGGCtgcaaaagcagcagctgcagcaatgcaCGTGCCAACGAATTCGAGGCGCAGTGCCAACCAGCAGTTGATCGTGAAATTTAGGAAA
TACGCACGCTggttcttgtccagcaggTAGTTGTTGTGGCCGATGAAATTGCTTTCAACGCCGAACGCACGGATCGTCGATAGTCCATCCAGCGTTTCCG
ACAGTAGTGCGAAGATCGGAGAACGACTAATAGAGtccaggcgctgcagctcgcgaGACGTCTTGATAAAATAACGCTGCGAGCAGTAGTATCCAGCCAG
AACGGGGGCCAGAATCAGCATGAAGATCGGAGTAACGTAGGAAATGGTAACCAACGTGATGATGACGGACACGATTGTGTTGAGAAGGCCAACAACGGTG
CCTGGAATCGACTCATCCAGCGTGTAGATGTCCTTCGACATGCGGTTCACGATGCGGCCGAGCGGAGTCGTGTCGAAAAACGACGTGGGGGCTCGCAGGA
TGCGGTTGAGCA