Description :
From Genome Similarity Track
Location :
Scaffold_423:3829- 4921
Sequence
1092 bases(100 bases per row)
AAAGCCTTGCTCTTGAGATGTGTGAAATACATTTTCCTACGGCTAAACAAACCACAAAGAACACAAACAGGAACGATGATGCGGACATTTCATCGACTGC
CATCATTTAGGGAACTACGTTTTTGAAAGAAAAAGCATGGACTGCATACATTAATCTTGTATACGGCTGTTTTAAGGAAAATTAAGTGCGAAAGGTCAAG
ATTTGAGTTTCAATAGGCGTATTTCTACACGATGGACTGTTCGACAAGCACAGCTATTAATGGATTTACACTGTCTTGTACAGTAAATCCCTTCTTAAGT
TTGTGGGACCTGAGTCTTGCGGCAGATGTGGCTACGATATAAATCACCTGTTTCGTCTTTATCTTACTAGGATACCTTTCATGTTGACATAAGGACGCTC
CTGAAAGTTAGCATGAGATGTGCTGTACCAATACATCTGTAAATATCCATTCGATACAACGAAAGCAATCGATATGCTATAGACGTAGAACAGAGTGCAA
ACCTTGTAATTGACAACGTACAGGTTGTCATCATTGTGGTCGAGTATTTGTTATTGCTCGCCAATTTTTGAATGTTATTTTGATCTTATAGTGCACCGCT
TCGTCCTCTAGTCGCAGTTGCACCTGTACGCTGATCGTCAGCGACTGCTATTCCCAGGCATTCAACGGCACTGATCCTTCTTCAATGTCTAAAATTACCA
ATGATGGGTTTGAAATATTGCAATTTCTTTTTATTGGGTGGACTGAAGTAGATTGGTCGGAATTCGAAAAGTCATTGTGTTATTTTTCAGCATCAAATTA
TGAGGGGTGTAATTGTGGTAATGTAGTGGAAATAGCAGATACGCAGATTAAATTGATTAGATCACTCTTGCCAAACCAACCATTACCCTACTTTTTCCTA
TCACCTTCTCCGTACATAAAAAGGGAGGTATCTGATGATGTTGTGTGCCTTCATTTCACATTCTTTTTCTCTGGGGTCTGAATGTCGCTTGACNNNNNNN
NNNGCATGAGATGTGCTGTACCAATACATCTGTAAATATCCATTCGATACAACGAAAGCAATCGATATGCTATAGACGTAGAACAGAGTGCA