Description :
From Genome Similarity Track
Location :
contig_24:382854- 384249
Transcript NameFunction/comments
g5433.t1RAW35747.1 hypothetical protein PC110_g7948 [Phytophthora cactorum

Sequence
1395 bases(100 bases per row)
CCACAAATTTGAGATGTCAGTGTAAATGTCGAATCCAAGCCGAGCCACAACACGAACTGTGCCCACATACGTTTCCATTTCGATGTGGTCTTCTCCTCTT
TTTGAGATGGCAGCTCGACTGGAAGCTACGCGGTTGGAGACCGCCTTTGCCGACGTTATTCCGCCAGATCCATGTGCAGTTTGCTTACTTGGCGACCGTA
GGCAGCTACTCACTACACGTCCCATAACGCGAATGCTGGGGCGCTTTCGTCGAATGTACAGGGTCACCACGAGCCCCACCGCCACCGCGACAGCCATGGA
TGCGACTATCGTGAACAAAGAGTGTCAGAGCAAAAGACGCCTCTACGTCAACAGCTTACAAATATGAGAGCGTACCTTGCCACGTTGCGTACGGGAATGA
GGGAAACAGTGATTGTGCGCTGGCTGAATCCAACGAGAAGCGGTCGAAGAGACCGTCTTCACCCTGTGGCTGAACCGCTTCTTCTCTGGCAAGAAACTTC
TTCCCGTCCAATACGCCTTCAAACACGTGCGATCGAAAGCCGCTGTGCGAAATGTACAGCGTATACCTCTTCGACGAATCCACCGCAGTGCCTGTAATCG
CTTTAAACAAAACGACCTGGCTCGTATCAGGCAGCACCACCGCTGGCATCACCAGAGGGAGCACAAACCCCGTCGATTTGGGCTCCACCCCATGACCATC
TCCTATCTCCACCAGCGTCAACCGATACAAATGCAGCGGCGTCTTCCCGTCGTTCTTGACATCCAATTGCACGTGCGTGAAGAACGTCTGCTGACTCGTG
GGTTCCTCCACGCCCCCCTCTTCATCCCCATCGGACCAAATCTCCGTCACCCCCAGCACAAGCTGCGGCAATCCACTGCCGCTAATCGGCAGCTCGTACG
CCGGGGAGACCGATACATGCCTCACCATGCCCGTGGTCTGGTCGAACGAGACCCGCTTCTCGTTCTCGAACAGCCTCTCCACCTGTCGCTTGGTCTCTCG
TCCCCAGGTCTCCAGCTTCTCCTCGATCTCCATATTTGACCTGGAGCACACAGAGGCGATGCCCATGAGTGCGATCGTGGAGGACTCGACGTCCATCGGC
TCCAACACGCAGTCCACCGCGTGCAGCGAAAACGTCCTCAAGGACGTTTTTAAGCGGCCAATCACCGCGTTCATGGGCGAGCTGCGTAGACACCCTTTGC
CGGTGGACGCGCCCCCCATTGCATTCTCCACGTCGAGACTTGGGAATGCAATTTCAATGCCCACGTCCAGGCAGAACACGGGCGGCGCAGTATCGTCCTT
GAGCTGGGGCTCCAGGCTGCGCAGAGACGGCGATACTTCGGCTGCAAAAGAGGCGGTTGTATACGCATGAAGCAGGAGGAGCAGCGACAGCATTC