Description :
From Genome Similarity Track
Location :
Scaffold_85:38280- 42159
Transcript NameFunction/comments
Phymu_g3840hypothetical protein
Phymu_g3841hypothetical protein PHYSODRAFT_345492

Sequence
3879 bases(100 bases per row)
TGACAATCACTCTCGGCATGCGCACAGCTCAGTATTACAGGCATGGCGCAGCGAGAGCTCCTGCATGAACTCGTAGAGCGCAGTCGCGAGCGCGTGGTGC
AGGTGCGCGCTGGTAGTAGTctgctccacgtcctgcaccaggagcagctgaaAGTTTCTCCTCCGTtggccacttcgacgtcattgccactgctgcctcc
CGCCCCCACGCTTGCAATTACAGCCAAACGCCGAACACACAAGAGTCTCCATGTAGAATCAGCAGATGGCGGCCACAAAGCTCGACGGCGACGGGGAGCG
CTGCCACGACTCGCCAAGGACGTGGTGCAGCTGCCCGAAGGCACGACCTCGTTCGAGCAGTATCAGAACTTCCTGGCCAACAAAATCTACAAACAGGAGA
CGATGCACCTGCAGAACCGTCGGGTGGCGCTCGTCCCCAAGGCAGATTTGCTCAAGAAACTGGCGACGGTCTGTGCTGCGGCGttgaaggagatggaggg
CGAGGGGGACGCTCCGTCTGTGAGCGAGTCTCTGAGAGAGAAACTGCTACGAGCTATGGCACTgcttcgaggaggacgtgctTTTGGGCAAGCCAAGTCG
CTGGCACCACCCTCGCCTCCTGCTTATGGGGAGATAAAGAATGCCCACCTGGCCTTCCTCCAGTTCAAGCACGATGATGTGAGCGCAACGAAGAAAAAAC
ATGTTCACCCGTGGGTATTTATTTGCGCTCAAAGGATTTTATGTCTCCTGCTTATGCTAATGATACGCTTCACTTTGTACGGTAGAGGTGCTGGTTTGCA
GGATGGCAATACGTCGACCAAAACTCCAATTCACTTTGGTGATCAAATTTGCCTACTCTCATCGAGCTCTGACTTACCCCTCGCTGTTGGGCACGACGGC
CGTAGTTGTCCTGCGCAAGACAGCTCTGCTGGACCGCACATGACGTTCACCATCGTGCGTTGCTCTTCGCATTCTCTCAGTGTGTTGGATGGAATGGGGT
CACTAACATTATCTTTGCTCAGGTGGACTTCCGAAACCCGTCGCGCTGCGATGAGGTCACTTCCACAGACGATTTCTGGCTTCGTGTCGACCCTGCAGTT
CTAGAACCTCGCAAGTTCGATCCTCGCCGACTTCGTTGCAATGGTGATGACACCGATCCATCAAATGATGGAGGTGACGGCGAGTTATCCTCGCTTCTTA
GTGACACAAGCTATTTTCTCGGCTGCCCGGGCTGGcaagacgatgacgagtcTAACTCAGTTCCTTTGAAAAAGGCATCGATATCATCGATTCGCCAAAT
TGACGAACATCGGCTTCACGGACAAAAACACTTTCGGCTAGTGGCTATGAAAGCTTTAACCCCGTCAAGGGATATCTACGGAGATGATGCGGCAACACGT
GAATATGCCGTGGAGACCAACGAGGGTATCATGCGCTTGGCACGCTGGCGGTTTGTGAAGTACACCCCACGAAAACACGAACAACTTGGCGGGAAGGCAG
AAGTAGCCCATAATGAAGCTGTTGGGGGTGAGCAAGATATTAACGACGCAATGGTGAATTGCTCAACGGTATATCTAGTTTTGAGCGACTTTGCACTCTT
TTACGATGCGGATCTCAAACGTGGTGTGGGCGTGCGCGTGTCTTCCGACGCTTACGCACGTTCGAATATGGGGAAGCACCGCCAAAATGGCATTGGTGAG
AAGGAACCTCGCCATCCTCGTGAAATGATCGCAAATATGGTGCATCTTTCCGCGTGTGCACGATGGCAAGTGCGTATCTTACAGCGCACAGGTGGCATCA
ATTATTTGCAGGAGCTAGAGTTGGCCATGGCGGCGGTGACTGGAGACTACCGAAAAGAGGACGGCGCGCGTGTGGAGTGGTTGCGTGAAAAGCAAGAGAA
AATGGCTTCGGACAATCGCCGACTACACGTGAAAACGAGGCTGGTACCTGAAGCCCGGCGCCAATACGATCTCGTTGCTGCTCAAAGTAACAGCAAGCTT
GAGCAGATTGAGCGGCAAAAGGGGGCACAAGCTACAGAATATTTtcaacggcgtcttcaccagctcgagacgcaggaAAGTAGGCACCAACCGTATGAGA
TTTTGCATTtgaaacagcaacagcttcaacgtgttGTTGAACTCCCGCGCCTGTGAGGCGAAAATGGACAATAACAAGAGACCCCCTCGTATGAAAACTA
TCCGATACATTTCTATAAGATTCGAACTGTTCTCACTATTCCTCGTTCTCGTTAGCTTTGGCTGGTTTTGCATTACCGTGCTTCTTACGCTTCTCGCGTT
TCCGACGCTTCCGGTTCTCTTTTTGTGCAGCAGACAGCATCTTCCGTTTCATACCAGCTTGAGAAGTCCTAGCTTCAGCAGTACTTTCAGTGGAGGAAGC
TGGCACAGGAGCTTCAGAAGTTGCAGAAGTTGATGTTTTAATCGCCTTCTCAGTCTTTTCATTCGCTTCTGCTGGAGCGCCACCAATTCGGTCAGCTCGT
TCGAAATACGCCACGAAGAACCCGTTCGTGGAATCCTCGAGGCCGTTCGCACGCACAAGAGCCTTGGCCTGGTCCGTCGACAAACCTGCCACCTCGAGTC
CACGGCGTGGCCATGAAGTCAGAGCGGGCTTCAAAACAAACGGCCGCGTGGCTCGAATGTTCTCGTCGGATTtcaaagctgcagcgacaacctcctcgtc
ttctttctGGAAAATGGAACAGGTCGAGTACACGACGCGCTCCACTTGtgggaaggagaaggccttgcgcagcgcctccagctggAAATCTGCGAGCGAT
TGGAGACGCTTCGCTGTGTCTTCCTCATACTCAGCACCATGGTCGGCTTCCAGCACCGTATCACGTGAGCTCGCAATGTCCAGCAAATGATCCAAACGGT
TTGTCATACCCGACCCAGAACACGACGGGTCCAGTAGAATACTACGCACATTGCGATACATCTCTCCGTCCACCGGCACTtccaggaagctctggagctc
cGCCTGGACGCGCGTCGCAGCACCTGCAAGCTTCATTCGTCGTTTCAACAACTCCAGCCTCTTAGGCGATCGGTCGAATGCAAACACTCGTCTTCTCGGT
GTGGAGTCGTCTTCCccgtcttcatccagctGCTGTAGTAGCATGGCCAGATGACTGGTCTTGTTGCCCGGCGCCGCGCAGGCGTCGATCACGTCCCCCT
GCTTGTCCTTGTTATCGGCGTGCTCTCCATGCAGCACGAAGGCCGGAAAACAACTGGCCTTgtcctgcagcacgagctttCCGCTCTTGACCATCTCGTG
CTCGTGCAGTTCCGTGCCCGAGGGCAGTACAAGCAGATCACGCACGTCTCGGTCCTGTTTGGCGTCGTATTCCTTCGTGAAGGCCTCGACCTCTTCAGGA
GAAGCCAGTAGTGTATTAACACGTACGTAGCGGGGCAGTGCAAGGTGCTGTTGGCGGTTCTCCGGCGGCAATAAAGCCTCATTGGACGCCACTTTGCGCT
TGATCTTAAGCCTGGCCAAAGCCGCTCGGAAGGCCGTTTGGTGCTGCACAAGCGCTTTCTTAACGTATCCACCGCCCTGAATCTTCTGGCGACCGAATAG
CAAGTCGTAGAGCGCCACAAACACGAGAGCAGGCGGTTCCTTGGCGTTTTTAGgcgtcttgagcgccttGTGACATTCGGGCACGGCTGCTAGCAGCTCt
cgcagcagcggcttgtagcgcagcgtctcgcaCACGAGCGCGAACGAGCTGCGCTTGTGCACCGTGGACTCGGCGTATGCGAGGCTCTTAAGCCCTCCCt
ggcgcagctcaagcttgtgcagcagcgccgccgcctccttgTAGAGTTCGCTCATGGCCAAAACGCAAAAATGGCTGGA