Description :
From Genome Similarity Track
Location :
contig_53:38270- 39616
Transcript NameFunction/comments
g8761.t1hypothetical protein
g8762.t1conserved hypothetical protein

Sequence
1346 bases(100 bases per row)
GAAACTCAAAGGCCGAACGCCCAGTCATGTAGCAAAGAGGGTCTGCAATTGGCAGTAGTGGAATTGTAGTGTTTTAGAGCTTCTAGCGCTGATTTAGTGT
TGTTTTGTTGCTGCGTAGGAGGAAAAGAAGCTTTTACTGAAGGAGCTGGCGTTCCTGGAAGCCAAGGCGGCTCTGCTACGTCAAGAGGCAGGGATTCCGG
ACCCGAAGGAGGTGGCGGCTACAGAGCAACAGGTTGAGATGAACCGACAATTGAGAGAGACAATTGCACTCCAGCAGAACGCTGTGGCGGCTGTCCAGTC
GGCGTCCAAAGAGTTTTCGGTGAGTTGGTGCACAATTTTGAGGTGTTTGTGGTTGTTAATGATGAGGACGTCGATGGTTCAGACACTGCGAGGGCACAAC
CCGCTGCAAAGCTACATCCATTTGGGTACAGATACGGATGCGCGGCGATCGGAGGTCTGTGCACTCAAGCACGAGCATTTGCAGCGGGCGAAGGAGTTTC
TGAAGCAGAGGATGCAGCTGGTGACAAACCCGAACCGACCTTTTCATGAGGAGTCTGGGCAACGGATGAGGGGCATTACATCGCAACGAAATTGGATGTG
CACCGATTTGTGGGTGTGGAGAGTGTCAAACAAGTGTTTGAAGCGATGCAGTTCTACTTCCTGAATTTGGAGATCACGACGACGGAGTTGGGGGCAGATC
TGACGGTGCGAGAAGACTCGAATGACCTGGAAGCTTGTATCCTCAAGAACCCCATGCTGCACCATCGCCTAGTGACAATGCTCTCGAACGGGCCGTTGGT
CGAGAAAAACGCGATCAAGTTTTTCCAGTACTTTGGCGACGATGGAGAAGAGGATGGTCCTTATGGTATTATGGCCGCTGCTCCTGTTGACCAGGACGAC
TTGTACCCGTACAACTCGGCAGAGCGTCTTCGTAAGGATGTATCCGCAGCAATGAAGCTGTCATCGTTCACGCGGAAGAAACAAGGTTATGGAGAAACAG
CGGAAGATGAAATTGTGGTGGTGTTGACGAGATGGTTCCGGATCAAGTTGCACCACTCGGAACTGACATTTCCGCCGCATGTGCTGCAGGAGGTTCAACG
CAGCGCCACATTGTTCACAGATCACATGGTTCACAGCATGAATCAGTCATTGTATGGTGTTCCGTGAATGCAAGAACTCGTCAAAACTGCTTGCATGTTC
GCGTCGTTAACTCGAATAACGTTATCTGCAATATTTCTACATCATATTTGATCCGTTCAAAAAGACAGCGACGGCCTTAACGGGACTCATAGATGACTCG
GTGCATGCTCTGAACCATCGTGTCTGAAAAGCAGGCCAGTCCTTGG