Description :
From Genome Similarity Track
Location :
Scaffold_178:38268- 39593
Transcript NameFunction/comments
Sapdi_VS20SDRG_17017hypothetical protein

Sequence
1325 bases(100 bases per row)
ACGACGGCGGTAGTCTCGGCGGTGCCTTCATGGATGTGTTTTCGAGCATTTTTGGGTAGATGTGCCGCGCTTCCCTTTGACGAGTCAACAACTTGACTAG
TCTTGTGTGTTTAATGCATACTAGTATCCAATATATTCCAACTTTGACTCGTTGTGTCAGACGACCGTGGCGGCGCTGCAAGCGGTGTCCTCTCTCACAA
CTACGACTTGTGCCGGACGTGTGCCGTGAACGACGACTCGTCTCATGAACCGTTCCTGCTGCGTCTGACGTTGACGATGCGGATGACGCCGACTGGGGTG
CTTGTTCGTGCTGCCAACAAGATCGACGCCGCGCTCGACTTTGCACGATGTGCTCGACTTCCTGGACGTTGCTTCGGAAACGTATCGCGTGGCCGAAGGG
CTACAGAACAAGGAACGCTTATATGCGTTTCAAGGTGACGACGAGCTCACGTTATTGGGGGGACTTCTATCCCGTCGATGGCCGCGTCGGCGAGCTTGGG
AACCAGATGTGCCCGGAAGGCTACACGACCTTCAATCCCGATGTGAGCTATACCACAATGCCCCCATTCGACGCTGTTGACGCGAGCACCGACTCGTTCG
TCGGCACGGACACTGCGGACCCGTCGAGTGGCATTGGTGTCGACGGCGTCGTCGGTGGCGCTGTCAATCTTGTGGGTTCGGTTCTCTGCATGATTTCTCA
GTAGTATTTTCAAGAAAGGCCAAAATTGTATCAATTTGATGTCTGATTTCAAGCGCTCTTTCATGAAGTTCAGTGTTATGTCATCGACTATAGCACTTGC
TAGCCGTGGATGGTCCCTTCCAGAGTACGCTGCCGCTTCCTTGGCAGATGCGCCGGGTCGTACGGATGCACAGGAGCTTGTGCGACGAGGATGTCCAACC
ACAGGACAATTTCTCGGTCCTTCTCGCGTTTGTGTTTGACGCGAAGGGCCTCCACGAGCGCGTCGCGGCTTGTAACGTCGCCCTTGCCTTGTCAATATTC
CACGCCCATTCGGTTTGGGTCAGCTCGAGGCAGCTCGGATACGTTGCAGCAATGCGTGCGACGTTATGGCACTGGCCGGTTTCCTTGCTCAAGTACAAGT
TGTCTTGGCATCTGTCCCAGAGGAAGTCGCGAAAGTGAGCGCACACCGAGCAGTGCGCGTCATTGACGAAAATGTCGGGCAGGCTAAAATCAGCAACGTC
GGGAAGAGGCTCTCGGACCCCAACAGCGTCGAACGTTGCCAAACATTTCGCTGCCACGAGCGCCGTCACGCGCACGAGCTTCTTCTCGGCAAGCGCAGAA
ATGGCGGGCAGCAGCAGCAATCGGT