Description :
From Genome Similarity Track
Location :
Scaffold_68:38254- 41338
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_68-snap-gene-0.34Novel protein
Pytir_DAOMBR486maker-pir_contig_68-fgenesh-gene-0.15F-box protein

Sequence
3084 bases(100 bases per row)
ACTACTCGGTGTACACGTTCCAGATGAAGACGCTGCCGTCTTCGCCCACGGACACGAGCTGCCGGTCGTCGGGACTGAACGCTACGCCTCTAACGTTGCC
CGAGTGGCCCACGCCGTCCATGATGAGCTCGCCCGTGTTGCCGTCCCAGAGCTTGATGAATCGGTCATTGCCCCCTGTCGCAAAGATCTCGAGACTGTGC
GCCACTGCGATGCATGTGGCTTCTTCGTCGTGGGCCTTCTGGATGACGTTGACGGGCGAGTCGATGCGCAGGTCCCAGAACGAGATGCGTTTCTCCTGGC
CAGCGCTCAGCACCAGCTTCTGGTTTGAAGAGAGTGCGACTGTGTTGATGCCGCCCATGCGCTGAATGTGGCTCGAGATGCGCCGCTCGGAGCGCAGGTC
CCAGCACAGGATGCTGCGGTCGCGGCTGCATGAGAGCACGTGCANNNNNNNNNNNNNNNNGTCGTCTTGGTAGAGCACGAGGCTCGTGACCGCCATCGAG
TGCTCTTTCAAGTGCGAGACCATGTCGCGCCTGCGGATGTCCCACACGCGCACCTCGCCCCCGACGCCCGCCGAGACGATGAACCGCTGATTGTGGCTCA
GCACCAGCGCCGTGACGCCTCCCGTGTGTGCGTTGTCGATGCTCCAGACCTGCTCGCCTGAGTCCGAACCGTGGCAGCGGATGGAACCATCGGTCCACCC
TGTGAGCAGCACGTCGAGCGAATATTGGAGACACGTGGGGATGCCTGCGTTACCCACGAAGCACTTTGTCACGACCGCGTAGTCCGAGGCATCCCAAATA
CGGATCGTGCAGTCGCGAGACACGGTCGCGAACCGGTCCGAGACCCCCGCGGCGTACGCGACTTGAACCACGGCGCTCGAGTGGTTCTCGAAGAGCAGCG
ACGCCTGGAGGAACCGCTGCGCGACCAGCAACTTGACTCGGAAAATCGAGCCGGCCTGCGTGCCGATGACCGCTTCGTTTTGCGCAGCGTTAAGTGCGAT
GCCTGCGATGGGACCGTCGAGCCCCACGTGGCACGTGTCGACGAAGTCCTGCTGGTCGTCGAAGTGCAGCACGCTGCCATCACCGCCGCCCACGAGCACC
CCAAAGTTGAAGAACGCGATCGAGTTAATGCCGCACGAGCACGCCGGCACGTTCTTGATCAGGCGCTTGGTCTTGACGTTCACGACGGAGAAGTCTCCGC
TGGAGCTGCCCGCGACCAACGTCTCGCGGTCCGGGGAGAACTGCACGCACGTGTAGTCGCGCACAACGCTCTGGTCAATCTTGGACTGCGTGAGCTCGCC
GTTCATTGGGTTGAGCACCCAGAGCAACAACATGCGCTGGCCCGCCGTCGCAAACTGGTAGCACGGCGTATCGCGCCGCTTGACGTCACGCGCCATGCCG
CCGAACGCGATGCACGTGACGATCGCCGCCAGTTTCTGGTGTGTCCCGCAGATGTTGCCCGTGTGCATGTCCCAAATGTACAGCCGCGGCCCGTCCTCCG
GTACGCCAATCGTGCAGAGTAGACGCTCGTCGTCCGAGAACGCGAGCGCAGCAATGCCGGCGTCGTGCTCTGAGAGCCGAAACAGCATGCGCTTGGACGC
GTAGTCCCAGATGAGCACGTCGGCGCGCTTGCCACGTTCCCCAGAGGCTAAGAGTCGACCCGAGTTGGACATCGCGAGACACGTGATGTGCGCCTCGTGG
CCGCGCAGAAAGATCTGGCTGTGCGCATCCTGGAAGGACGTGAGCAGGATCGACCCGCCGGACGGATAGAGGTACTCGCTGCTGGACGGGTGGTAATGAA
TCGCATTCGGCACGTTCGCGGAGAACCCGATCGTATGCTCCAGGTCGATTGCAGGGGACGGTGGAGAGTTCGGCTGAAACTGCTTGGCGTTCTGATAGCC
CGCGCCCATCGTGCCTCTTGTCATCCCTGTCAAGCCTCGATCGAAGCCAGGTGCGCTGTTGTTGTTGCCCTCATATTGCATGGTCGCCGACGATGCTCTA
AGTCACCAAATGCGCTTCCTGAAATGCCTGGACATAGAGGTATAAAAAGCGAGGCATGGTTGCTTTCAAGAATAGCTTGGGGAGTGCAGTGAGAAGAAAC
CACTTCTAATTGTCATTTGTTACATTGTACATTGTTGGTCCCAAGACTCACTCACTCGCACACGCCACCGATAGAAAGAAGGACCATGGAGACTTGGGGG
GATGGAGGGAGGCTTGAGAGACCCTAGGTAGTCTCAGTCAGCCTATAACTCGGTGGCGACGCGTCCCGTGGCGCCGACGTAGCTAAGGCAGATGTAGAAC
GGCGGCAGCAAGTTGTCGCGATGCCACTGCATCATCTCGTCTCCCAAGTCCTGCTGCCGATCGAAGAGGTTGAGGCGCAGCACACCGCGTCGCAGGAATA
CTTTGCGTGGCAGCTCAAACTCCTGCATCTACATACACGTATAGTCAATCCACGCAGTTAATGGCGATGCTCCTTAACTTATTTAAGATAAAGTAGAGCC
ACTCGTACCTTCATATCGCGGATCGCATTGTACACTGGCGACTCGTAGATCGCATAGCTGAGCGTCTCCTTCACCTCATCACCATCCGAAGTGACTAGAA
GCTCATGGAACGTGAACGACAGCTGCAGCGGTGAGTACGTTGGGCTGCCCGGGTACCAGTAGACGCGGTAGGGAGACACGCGCACGCTGCTCACGAGGCA
GTTTTGGTTCATCTTGTATTCGATATAGTCTCGACTCGAGTGCTTCCATGACGCCGTTCTTCACATATTACAGCAGGTTGGTGTACAGGGAGGCTAAATT
AGAAACTGCTCAGCCAATTTTAGTGCAATTTCCAACAAACAAAAATCGACAGGGATTCATTCGTACGTGCTCCAGTAGCAGGGGCTGCCGCGCGCGCAGC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCTGCGCCCACTCGAGGAAGATGAGCTCTTGGTTCGCGAGCACGCTCCGCGACAGAAAAT
CCACTTCAACCTCGCAGGACGACCGCGTGAGTGTGTTTTCGGGCTTCTCACCCGGGTTGTCCACCGACGAACACTCTGATGTAA