Description :
From Genome Similarity Track
Location :
Scaffold_143:38250- 39595
Transcript NameFunction/comments
Hyaar_Emoy2810989conserved unknown protein

Sequence
1345 bases(100 bases per row)
GTCATCACATGTTCCGTCTGTCGGACTTTTTCTACAAAGAGATCTTTGGCGTTCATGATATTAAACAAAGTGATGGCGTGCATCAAGAACGCGTGCAAAA
CTTTTTTGTTGTGCCGTTAAATACTGAGCAGCTGTTTCTCTTTGGTGTGCTGCTGGCACTGGATAGTTTTCTCTACGTCTTTACGTACATGCCACTCCGG
ATTTTATTTGCCTGTGGCTGTGCCGTGACTTCAAGTTTTTACGCACGGATATTTCGACGCACGCACTCTGCGACNNNNNNNNNNCTGTGGTGGATTCTTT
TACGACTTGATGGTGGCAGTGATTATGGCTGTAGGGACAACTGTGCTAGGGTACGTGGACATGTCGAGGGTGTACCACGCCATTCGCGGCCAGGCGATGA
TTAAACTCTACGTGCTGTTTACAATGATCGAGATCTTTGATCGCTTGTTCTCGTCCTTTGGACAGGATGTGCTGGACTCACTGTACTATACAGCCAAGTA
CCACCCCCGTCGGGTTACGCGCATGTTTTTGGACTTTAGCGTGGCAATTGTCTACGTGGTGCTCCACTCGTTACTGTTGTTTGCCCAAGTTGTGACAATG
AATGTTGCAGTCAATTCAAGCAACACGTCACTGCTCACGCTCCTCATTTCCAACAACTTCGCCGAACTCAAGAGCTCGGTTTTCAAAAAGTTTGAAGAAC
AAAATTTGTTCCAGATCAGCTGCAGCGATATCGTCGAGCGCTTCAAGCTGCTCACTATTATCGGACTCATTCTGCTTCAGTCGTCGACTGGCGATGTCGC
CTGGGGAACGGTAAGATGCTTTTGGTTACTTACATTTTTTCATTGGTGTGAGCATTGTTCTCAGCTAGTACGCACTGCTTCTGATGTTGTTATTTGTTTG
CTCGTAGGCCATGGTCTGGGTGGCTGAGATGCTGATTGATTGGATCAAGCATGCCTTTATCACCAAGTTTAATCAGATACCGCCCACGATGTACTCCAAG
TTCATCACAATTCTTTGTCGGGATCTCACAGGCTGGAAGAGCGAGAACACAATTCTCGATCATACGCACCATGTGTCCAAGCGTTTGGGTCTAATGTCGC
TGCCTTTAGCGTGTGTGGTGCTGCGCATGTTGTCGAAGGCTCTTGCCGACGCTCCGATTGAGCTGACGTCGCCTAGTGGCATCTTGATCACGGTGGTGTT
TTTCATGTGTCTCGCAGCGTTCAAAGCGCTGCTGAGTCTTGTGCTGATGATTTACGCTTACAAATCAGGTCGCCTGGACGACACACGTCCGAAAAGTCCA
CGGTCCGCGCGCCATCTCGAGTCCATACATCGATACAAGTTTTGA