Description :
From Genome Similarity Track
Location :
contig_24:382410- 383804
Transcript NameFunction/comments
g4593.t1hypothetical protein

Sequence
1394 bases(100 bases per row)
CAAGCCGAGCCACAACACGAACTGTGCCCACATACGTTTCCATTTCGATGTGGTCTTCTCCTCTTTTTGAGATGGCAGCTCGACTGGAAGCTACGCGGTT
GGAGACCGCCTTTGCCGACGTTATTCCGCCAGATCCATGTGCAGTTTGCTTACTTGGCGACCGTAGGCAGCTACTCACTACACGTCCCATAACGCGAATG
CTGGGGCGCTTTCGTCGAATGTACAGGGTCACCACGAGCCCCACCGCCACCGCGACAGCCATGGATGCGACTATCGTGAACAAAGAGTGTCAGAGCAAAA
GACGCCTCTACGTCAACAGCTTACAAATATGAGAGCGTACCTTGCCACGTTGCGTACGGGAATGAGGGAAACAGTGATTGTGCGCTGGCTGAATCCAACG
AGAAGCGGTCGAAGAGACCGTCTTCACCCTGTGGCTGAACCGCTTCTTCTCTGGCAAGAAACTTCTTCCCGTCCAATACGCCTTCAAACACGTGCGATCG
AAAGCCGCTGTGCGAAATGTACAGCGTATACCTCTTCGACGAATCCACCGCAGTGCCTGTAATCGCTTTAAACAAAACGACCTGGCTCGTATCAGGCAGC
ACCACCGCTGGCATCACCAGAGGGAGCACAAACCCCGTCGATTTGGGCTCCACCCCATGACCATCTCCTATCTCCACCAGCGTCAACCGATACAAATGCA
GCGGCGTCTTCCCGTCGTTCTTGACATCCAATTGCACGTGCGTGAAGAACGTCTGCTGACTCGTGGGTTCCTCCACGCCCCCCTCTTCATCCCCATCGGA
CCAAATCTCCGTCACCCCCAGCACAAGCTGCGGCAATCCACTGCCGCTAATCGGCAGCTCGTACGCCGGGGAGACCGATACATGCCTCACCATGCCCGTG
GTCTGGTCGAACGAGACCCGCTTCTCGTTCTCGAACAGCCTCTCCACCTGTCGCTTGGTCTCTCGTCCCCAGGTCTCCAGCTTCTCCTCGATCTCCATAT
TTGACCTGGAGCACACAGAGGCGATGCCCATGAGTGCGATCGTGGAGGACTCGACGTCCATCGGCTCCAACACGCAGTCCACCGCGTGCAGCGAAAACGT
CCTCAAGGACGTTTTTAAGCGGCCAATCACCGCGTTCATGGGCGAGCTGCGTAGACACCCTTTGCCGGTGGACGCGCCCCCCATTGCATTCTCCACGTCG
AGACTTGGGAATGCAATTTCAATGCCCACGTCCAGGCAGAACACGGGCGGCGCAGTATCGTCCTTGAGCTGGGGCTCCAGGCTGCGCAGAGACGGCGATA
CTTCGGCTGCAAAAGAGGCGGTTGTATACGCATGAAGCAGGAGGAGCAGCGACAGCATTCGCAGCAAGTCGCCCATGTTGACACGGAACTGACT