Description :
From Genome Similarity Track
Location :
Scaffold_153:38240- 39407
Transcript NameFunction/comments
Phyra_85216reverse transcriptase

Sequence
1167 bases(100 bases per row)
GCAGGGCGATAAGGCTTGAGCGAGCCCACGTAGAACGTTAGATGCGTGGCCATGGCCGATGGCAGGTCCAGCGTGTACGCGTTGCCGTGGACCCCAATGA
CCGTGAACGGCCCCACGAATCGTGGCCGAAGCTTGGTGCTGCCCACCGCAGTGATTGCCTGGATAGGGAGATTCTTAGCGTTTAGGAGGACCTGGTTCCC
AAGTTTAAATACGTGCGTGTTCTTACGCCCTTGCCTGTCACTGTGTTCCTTTTGCGTGTCTTGAGCAGCCGCCATAGCGTCCCGGACGCGCTGTCGTACT
GCTTTACTTGTCTCGATGAACGTGAGGAGGTTCAGTTTGACGGACGAACGGAGGCCTTGGAGGCCACGCGGATCTTCGGCGATTGCCTCTCCCCCACCCA
AATTCGAAGCCGGTGGCAACGATAGCGGCGTACGCGGATGCCGCAAGCCATTTACATAAAATGCGGTGAAACCCGTCGACGAATGCACAGCATTGTTCAG
CGCAAACTCCACTTGGGGTAGCAGCGTGCTCCACTTGGTGGGTTCTTCAGTGCAGACGCTGCGCAGTACGTCTTCCAACACACGGTTCACGTGCTCCGTC
TGACCATCGGTCTGTGGATGGTCCGCTGCGGACATGTCCAATCTCGTACCGAGAAGTCGGAACAAGTGTGTCCAAAAGTGTGACACAATGCGCGGATCTC
GATCACTCACGAACGCCTCCGGGAGGCCATGGTGTCGAAAGACATTGTCGACGAAGAGCTGTGCCGGTTGCGACGCCGTCACGCTCTTCTTCACCGCGAC
AAGCCGCACCATCTTGCTCAGTCGGCAGACGAAGACCAAGATGCCAGTGTGGCCGCGCGTGTCCGCCGGAAGCTCAAAGATGAAATCCATGCTCACCGAG
CGCCAACAGTCAGCCGGCACCGGCAAGTTCATCAATGGAGCCGACGACGATGGGGCGGGCTTCACGCGTTGGCACGTCTCACACGTTTGCACGTACGTTT
GCACCCACTTATACATATGTGGCCACCAGAAGTTGCGCGCCACGGACGTATACGTCTTCTCTCGGCCAAGATGACCGCTGAGCGGCGTGTCGTGTGCCTC
GTAGAGGACTCGATGACGTACGTTCTCGTCGTTGGGAACCACGATACGGGGCTCGTCGCTTTCGTCT