Description :
From Genome Similarity Track
Location :
Scaffold_19:38238- 40994
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_19-fgenesh-gene-0.43-hydroxy-3-methylglutaryl-coenzyme A reductase

Sequence
2756 bases(100 bases per row)
GTTCGACCCACTACAACCGAGTGCGCATGAAAGCGAGTCGTGGTCTGCGTCGTCCACGACGAAAGCAGCACCAGCCAACTCGTCGCAGCCATCGATCTGG
TCGGGATTCTACAACAAGACGCTGCGCGAGCGCTTCGACGTGCTCTCGCTCATGTACCCTCGCATTGGCCGCATCAAGCAGAGCGACTCGCAAGATCCGC
CGATTGAATCCGTGGACCCCGTGGCAAAGCTCGGCGAGCTGCCCATGCGCACCGCGAACCTCATGATTGAGAACTGCATCGGCGTCATCGGCATTCCACT
TGGGTGAGTGGCCATTCCCTACTCTCTGTATGCGCTGCGTGCTGGCATCATGCTAACTCTGTTGTTATTGTTGTTATGCAGGCTGGGGCTGAATTTTGTG
ATCGACGGCAAGAGCTTGTCAGTCCCCATGGCTGTCGAGGAGCCCTCTGTGGTTGCTGCTGCGTCCAGCGCTGCAAAACTGGTCGCGTCTTTCGGCGGTG
GCTTCCGCACTGCGACCTCGGGCAACATCATGACATCGCAGATCCAGCTCGTCGACACTCCTGATATCGAAGTTGCGGTCAAGGCGATTGCAACCCATCG
TGAGCGTTTGCTAGCGATTGCGAACACGACGCTGTGTCCAAACATGAAGAAACGCGGTGGCGGTGCGCTAGACATCTACTGCAGGATCGTGAGCGAGGCG
TCGCGATCCAAGTTCTCACGCAAAGGAGAAGAAAAGCAGCACTGGTACGCTCCGTGCGATGACGAAGTTGTGATCAAGGCATCCGAGTCGAGCGTGCGGT
ACCTCGTGGTCCATATCGATGTCGATGTGTGTGAAGCAATGGGAGCGAACATCGTCAACACTGTCGCCGAGGGACTCTCAGACGAAGTCTGCCGAATCAC
GAAGAGCCAATGTGGCCTTCGTATCTTGACGAACCTCTGCATGCAGCGTCGTGCGCGCTCAGTGTTTGAGATCCCAGTGAAGAAGCTCGGCTGGAAGGGA
GTCGAAGGTGAAGATGTCGCACAGCGCATCGTGGAAGCGTACAATTTTGCTGCGATTGATCCATACCGAGCCGTGACGAACAACAAGGGCATCATGAACG
GAATCGACTCGGTGGCGCTCGCGACCGGTCAGGATTGGCGTGCCATCGAGGCAGCGGCGCACTGCTATGCCAGTCGGTATGGACAGTACACTTCGCTCTC
TCAGTACGAGATCACTAGTAACTCTGACGGCGTGCGCGTTCTTCGCGGTCGTTTGGAGCTTCCCATTGCGGTCGGATCGAAAGGCGGCGCTCTGCAAACC
CATCCTGGGTACACTGCCACGCACGCGATCTTGCAGCAGCCAAGCGCTCGTGCGCTCAGCAGCATCATCCTCAGTGTTGGTCTCGCCCAGAACTTTGCTG
CGATTCGAGCCATCGCCATCACGGGCATCCAGAAGGGACACATGGCTCTCCACGCACGAAACATCGCCGTGGCTGCTGGTGCGCCGAGCGAGCTGGTCTC
AGAGCTTTGCACGTACATGCTCGGACGCAAGAGTATCAACATTGAGACTGCGAAAGAGTACCTGCACGCCCACGCAGTGTACTCGGAGATCCAGAGCAAC
TCACCTCCGATTTCGCCTGTGCCCGTGACGTTGCCGTCCATGTTCTATGTGGAGATCCCAGTGCCGCACCTGGAAGGAGCGATCAGCTTGAATATCGCGT
TCGAGTCGATTAACAAGCACCCGCAGTACATTGCGATCATGGCGCCACCGAAATCCAGTGGTGACTCGAGTTCGACATTGACCAGCATCCAGCGACAGCT
TTTGGGTGACAAAGGGTACAACCAGCTCGAGAAGATGTTTATGTTTCTGGCATCCATGCGCTCGATTGTCATCTCGGAAGCCGGTGATGAAGGCGAGGAA
CTCCAGGCGCGCGCGAATCTGGCGCTGCAAAACAAACTGCAGTTGCTCTCGATCTTGATCAACATCCTCGCGTACCGACTGATGGAAGTGCGCTCGCAGA
CAGTGAGCGACTTTATGCGGAAGATTTTGGAGTGCGGAGACATCCGCAACATGGACGTGAAGCGGTGCCGCAGCATCCTCGCGGATGTGCCCGCGTCCGA
CGAAGTGGTGTGCACAGGTCTGCCTCTTTTCCTGGCGCTCTGGCAGGTGTTCCACTACCATATTGAGCAGGAAGTTCCTCACACGCTTCTCCGTGAGCGC
TTGGTACTGGAGCAGTGGCGATTACTCAACTCGATCGTCAAGAGCTACGAGCTGGGTCAGGCGACGGACGCAGTTGCTGTGCTCACGACAAGCGGCGAGC
TCAGCGATAAGTTCCTCGCGCAGATGGCTGTGCAAGCCAAGCGCTGGCAGGCGACGTTGCTCCTGCTCATAGACTCGTTGACGCTCGCCTCCGACGTGTT
GACTTCCGAGCGACTGGATTTTTTGAACCGCGTGGGCGAGCACATGGAGTGGGAAGGCACGATCGCCCACGACCTCGCACGGTACACGCGCGCTGTGACG
GAGCGTGTGCCCAATGCCTTCCTGTTTTGGCTCAAGGAGCGTGGAGTCGATGTCATGGACGCAGAAGACCACGTGGACGAGTTCCAGCGCGTCACGGACC
TGTACGCTGCGAGCAAGTGGAAGGTGATCACACAGGATAAAGACACTTTTGCGGCGCGTGTGTTTTCGCTCTCGGCAGTCGAGCGCGTGATCCGCCTGAT
CCGCGAGATCTACGGTGAGCGTAGCGGCAGACGATCACGGAAGGAATCGTTTTAGG