Description :
From Genome Similarity Track
Location :
scaffold_707:3823- 5488
Transcript NameFunction/comments
Pl_102852hypothetical protein PHYSODRAFT_484119

Sequence
1665 bases(100 bases per row)
GGGGCTCACAAGTGTTACGTGCTATATAGACGCATATCCGATCCGCCTTGGAGCGAGCTGATGTAAACGTCGAAGAAAAGACACCCAAGATCCTGCTTCC
AGCTATTGATCATGAGGGAAAGCAGAGTAAAGCTGCTTGAGAGAGTAGTGCCAAATTGGGAGGTGTAGGTAGTTTTCTCCAAAGAAGCCAAGTTCTAATC
GGATGAACTCTGCCTACTCTCTCTTTGTTTCTATTCACGTCGGCTGTTCACTACAGCAAAAATGTTTAGCTCAAAGTTCTGCATCCACTCGCCCTGCTCC
ATGACACTCGTTGGATGTCATCAGTTTTAAGCTTTGGCGCGTGGTCGCAGCTACGCGATTGGCCAATTCAAAGTTGACCAATCTTGACGCAATCGACCTT
CATTCCTGTAGCTTCTGCGGTCTGCCGTGCGTCAGCACTATCGGATCTGCTCGCACGATGTCGCTGCTCCACGGCCGCAGCATCTTCCTGCGGGGCGTGC
GACGCCTCGAGGCCGTCCATCGAGCACCCACCTCGTCCTCGTGGTTGGGTCGTCGCCCTGCATCCTTCGTCCTTCCTGCGTTGGGCAATGGAGCGCTGAG
CTTCTCGACGGCGGCACTGGATGATGACAAGAAGAAGAAACAGCAACTGCAGCAGACGAAGCCGAAAGCGTTGAACGCGCTGAGCGGCATGGGACTTGAC
CGCCCGCCCGACACAGCCAAGGAAATTCTGAGCTTCCTTATGGGCCATCTCTGGCCTAACGAGGACTCCAAGGAGGCCAAGGAGATCAAGCAGAAGGTGC
TCATCTCTGCGGGTCTCGTGGTGGCGGCCAAGGCACTGACCATCCAGGTGCCGTTCATCTTCAAGGATCTAGTGAATAGTGTGGGTGAAGTCTCCACTGT
GTTGGCGGGTTCGCCAGAGATCACGGTACCGCTGGCCATGGTGCTTGGCTACGGACTCGCGAGGTTTAGCGCCAACGCGTCATCCGAACTGGCCAACGCC
GTGTTCGCGACGGTGGCACAGAAGACCATTCGCAAGGTGGCAGTGCGCGTGTTCAACCACTTACACGCCATGGACCTTAAGTTCCACTTGGACCGACAGA
CTGGTGCGCTGTCACGCATCATCGACCGCGGTTCGCGCTCGATTGACTTTGTGCTGCGTGCAATAGCGTTCCGAGTGGTGCCGACGGTGTTGGAGATCGG
GTTGGTGAGTACCATCATGGCGACGAGCTTTGGACTGCCGTACGCTGGTGTAACGTTGGGCACCCTTACTGCCTACACAACGTTCACGGTTCTGGTCACA
CAATGGCGTGATGAAATTCGTCGTGAAATGAACCGGTTGGAGAACGAAGCTGGTGCAAAGGTTATCGATTCATTGATGAACTACGAAACGGTAAAGTACT
TTAACAATGAAGAGCATGAGACCGCGCGCTATGACGAATCGCTTAAGGGATACCAGCAAGCTGCACTCAAGACGCAGACATCTTTGGCAATGCTGAACGC
TGGACAGAACGGTATCTTCAGCGTTGGTCTCACTGCGATTATGTACATGGCGTGCGAAGGAATCGCTGCTGGTACGCTTACTGTCGGTGACCTGGTGCTT
GTAAATGGTTTGCTATTCCAGCTGTCCATTCCGTTGAACTTCATTGGGAGCATCTATCGTGAAGT