Description :
From Genome Similarity Track
Location :
Scaffold_4:382286- 384723
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G002047Similar to PIH1D1: PIH1 domain-containing protein 1 (Bos taurus)
Pytul_DAOMBR144PYU1_G002046Similar to Prosc: Proline synthetase co-transcribed bacterial homolog protein (Mus musculus)

Sequence
2437 bases(100 bases per row)
CGATCGATGACGCCACGATGGAGCAGTATGCAGACGTACGATACACTGCGCCATAAAGATTTCTAATTAACGCATTGCGGAAGATGACTGACTGACTGAT
GCGTTTGCATGTGTAGTGGCTGGACAATCTCGAGCGCACGGACCCACAGGCGTACAATCAGCTCATCGCGTCCATGAAGGCGCAGTTGGAGAGCGCAGGA
CCTGCGATGCCAAGTATGGACCAGAAGGGCGACGCAGACTCGGCGCTGTTTGAGATGCTCAAAGCCACTGCAAAGACGGGAGCTGGCACTGCCAATGACA
AGAGCGACAACGCGACAGGTCCAATTTGCAACCGATGTGCTTTCTGGAAGAGTTTGGATGATTGCTTGAGCACTAAACTGGAGATTGTTTTACCTAGACT
TCAAGCCGCTCTTTCCAGGCAACAAGGTGATGGAAGCGAGCGGGTTGGCTGCAAAACAAGAGGGAGTGAGTGCACTTTTATGCTGTACACACTGCGGCTT
CAGAGCTATATGCAGGAGGTAAGCGCCATGGCCCTAACATTGTTGGGGTGCTATTTGCTGCGAATCTAGGTGTACATTGATGTCCACCCAGGCTTCGTCA
TGAAGACAAGTGAACTGAAAAGCGGGAAAAAGGTTACGCATTACAACTTCTCGCGGACAGTTTTCACCACAACCCCGCTGAGATAAGCCTGACGTGTTTG
CGTTCGTGTCATGGCGTAGGTGTTTGTGAACGTGTGCTATTCGGACGAGATCCAGACGTTCTCGCAGCAAAAGAAGCTCGACGACGAAGGAAATGAGCAG
GAGGTAATGCACATACCAGTGAATGCGTTGAGAGGGTTCACTAGTTGTAAACTAATTAAGATTTTTTCCAACGATTTAGGGGATCCACGTACCACTGAGT
CTCGGCGCGCTACATGAAGTAAAAGACAAGAAAGGCACCACGTCGTTGGCGTTCGACGTCGCTGTGAACACACAGGTTGTCGAAGACTGCAAGATCGATA
AAACGGGCTCGTTTCGCAACTTTGTGTGCGAATTAGCGATCGAGTATATTGACCAGAAGGTACATTTTGCGTATATTTGTTGCTGCCATTGTGGCGTCCT
ACTTGTTCCACTCAGCTCACCGCGCGCAACGAATCAATGCTTGTGTGTATGTCCCGGGCTCCGCCATGGTCTAGTACAAAGTCAAGCTTGACGCGCGCTA
TAAGCTTCCTCGTCTCTCCTATCGAGGCGATTTATCGCCACCTAAGCATTACATTCGGAAAGTAGCGGCGCCAAAGATTCAAGATGTGACCGGCAACTCC
GCGACAACCTCGACCAAGACAGTGAGGAAGAAACCCGATCAGCCCAGCCCCCCTACGATATCTGCTACGGCGCGCTGGGAACTACATGAAGTGACGACGA
AGAACTCCAATGGTGAGGAAAGGCTACCATGCACACGCATCGCTACGGCTGAGAAAGACGGGAAGCCGCTCTCGCAGCAAATTCTCCAGCAAGCAGGAGA
GTTTCTGGAAGTAACCATTTGGTTTCAGACTCCCGTCGAGTCACCAGAGCAGCTTGAGATCGAGCTTCGTCCAGAGCTGCTTGGCGTTAAATCGCATGCT
CACCACGATCTAAGTAAGTCGAAGCGAGCAGCTTTTCTTTTATCTGTACGCAAGCCATCTCATAGTCGCCATTATTACATTTTTGTATGTAGGCATCTTT
CTGCCGTACCCAGTGCAGGTGAGCGCCGCTCAAGTCGCCTTGAATTGGGCGAAAAAGAACCTCACGTTAAGATTTCGTGTCGACAAAACGTGGGGTACGG
AGAACCCGGATTGCGGCTCTGCACCGTGGCTGTTGGCTCAAGCACTGCATGGCAACGAAGACGGAACCGAGATTAGGGAGGTGACGAAAGGCCGTGAGGA
ACAGAAGAAACCCAAGTCCCTGGCAGAAATGTTTCATCTGGAGCGACCAGATGCTAGAGATGCTCCTCAAGCGAGTGCGATGACAAGCCACGCCACAAAA
TGGGACCCGGTGGACGACGACGAAGAGCTCCCAGAAGATCGTTTCCATCGGAAGGATATGATGTCCATGCACATTTTAGAGCAGCGCAAAGCGGAGCGCG
ACCAGAAAGCCAAAGAAGCCAAGACGAAGCGGAAACAGCAACGAGCCGAAGTCGAGGAGAAGCAGCGGAAAGCGAGGGAAGCGGGCAAAACGTGGCGTGA
GATGTATCCGAACGACCCAGAGACGACCTATATCGACATGGAGGACATCTTGGAGCAGCAGAAACAAGAGAAACAAGCCGAATCCAGCAGCGTTTTTGCT
GCTGCAAGTGCGAAAAAAGAATTGGACAAATTGCAATTCATGCCAACGAAGGATGCGATCAAGGTTGCTGCGGCGTGGTCGGAGAACAATAAAGATGCGA
ACTTGGACTTGAGGTCTGCGCTAGCGTTTGAATTGCT