Description :
From Genome Similarity Track
Location :
Scaffold_18:382278- 396599
Transcript NameFunction/comments
Phyca_LT1534110361Hypothetical protein
Phyca_LT1534110353conserved unknown protein
Phyca_LT1534527326predicted protein
Phyca_LT1534506214AlNc14C38G3286
Phyca_LT1534110254PREDICTED: DEAD-box ATP-dependent RNA helicase 41-like
Phyca_LT1534110544Hypothetical protein

Sequence
14321 bases(100 bases per row)
gatgctgcaggagagtttaggaggaggcgactctgctgctaatgccaggagagcgctcgtccaagtgcagaagctgctgcaacttgcgtctgtcagaccc
aacgcgttgaccctacgtgaatatcgtgaggggctggaggtaacacaaaactttatatacaactaaaaaaaaaaattaatgcttttccatatctatagga
atgcttgaagtccgaggggagccctgcaatgaaagtgttagggttccaactcgctgcaattgctcctggatgctgcacgtacgaagtctggaagttcatc
ctggaagcggtggtaacggagcttggcagttcggagaatctgtcaactttagctgctgcgattcccgtgctcggacaagtcccaatacctcttctgcttg
gtttcctgttgtctcctgaaagagagcccatgaacaagatgcgtacacttttaactcacgaagatattgaggttcgttgtggcgccattgagacgctgtc
gaaggtaacgataaatgtggctattaacgttgctggagacggactgtttgtctttccgttcgagtcgcacgaggctcgaatttgctgtcaacaagacttg
gagacgatggtcaacgactgttggaagttgattttacacgctctttctgttgacgggcagtctcaaagtgctgcgtgggctgcgggtactgccttcacag
ctttagcgactctgttcgcacgttccagcacgttctcgccgttttttccgagcactcaagatggtagccgcgttcaaacgcccatagatgatgtcgcttc
gatgatctacaagcaagcagccccgagagttcgagtactgattactacagctagaaatcttcccatgaagcagcagccggacgctttactttggatctcg
atgcttctttacaccatgatggagcacagtggggcacgatgcccaagtgtaagtcgcccatacgtggagattgatactgaagataacaacgctgataaca
tcgacgatgacgagtcccaagcttccacagagcctgctcgagtggacgaattggcgaataatttactcgaatcctgggcttttccttcagtatcgcgacg
agtttcgttaggccaggctaccagcatgtgccgtgccatcttcatcctgctgtcgcattctcttcagacgttcactcgcatgggttgggctgctcagctc
accaaccacctgatcgcccagtgctacctcgctaacaagcgctccaatcctgagcttaaatttgagcttagtgtgatgctcgtgaagacgtttgcttggc
tgtctggagtgaattgtcagtcgctcttcgtccggacaacggaagctctttatctacttgaccaagaaaaagatcgacgtgatctggtgaagaatttgat
ggataccattgccaagcacgttatcacaagtcgagactttcagctacttcagggtttatgcacgatggcgtttttcaggcaaccaaaggggttttctaga
ttatccccacgcacgaacggctcggaagtcgttcgagccctttttcaatctctcgccaatacttccgtgcgtcgaggagctgtcgaacaacaaatctcgc
agcttattgccttgagagttttccggggattacttcttctgaaattgggtgggtctgctactacttcaccgaaggcgtaccgtcgctcctgcgagatgag
cgagaacattgtttactacacggggctactgacgtctcatttccaggggatgttggcttgccccaatcttgctcttcgcgagtcactcgagttttttcag
caagaactattcccaaccatggaccaaattgcatcgcagtgtgctcgccttcaaattctttgggttggtgtgcagcttcatcgcaattacgccacgcacg
taccttttgactctctggtacgagagcttcagcgcgaaactggtcggctttttactgcgatctggaatgaggatgacgaggtggaaggcgcaactttcga
caacggcttgcttggtaacggggggactggtgcagaagaaactcctgcgagtcgaaaacgtgcaggtgatgtcaataatgtggacgctttgatggtgctt
ggcgactgtatcacactgttagcacagcttcagccccaaacgcaattgcagtttctccagatgtgtgagaaaatgggtgctgctttatcggcttccggag
gtcccccagcgacgacatcccaacagtaccgtgtgtacgtttagtacgacttcatcttgcttgcgagctgatgagctaacctttttgtgtctggacagta
ttgaagatgttatggctgccctttcaacccctgtaccagcagatttaccagtagaacttgataccccattatcaaaagaaatattcgacccagcggatat
tttcctgccacgaaaaaatcttgaggcaaacgacaaggaagaaaatctacacgacgaagaatttcagaagccgatcactgtaacaggcagcgctgatcct
gtatccatccgaatctcccaccaccacccgatgtctgggaaggaagagattgttgaacttgacatcagttgctgcaatctcactacttgggcgttgaacg
atttggaaatccaccttcgtccgcttggaggtgtcggtgtggtgaagtgcgtggatgtatcgaaggacttgaagttacgtctactacgtgccggtgagac
tgtcagtgtcggcacaagcggaggttgcactagtttaccaccttttggcgtgatcaaagcacacaaacagtttcgcgtttgcaagttcacccaggctaca
attctggttcaagcagtgctcgttcaggatcctattcaagacagtgacgacatgagcggcaatccagaggagtcttctccaattccgatccgattagcat
tcagcaacgaatacgtgctgcacttcgacactctgcttcgacttccacagcctcatttcgcaaccgcctcattcttccagcactgctggcaaaggtatag
tgttatcctctcgatactagtactatctcgtctgtactaaacaaactctcgctctagtgctgcctcaagcgcagtttggcgtgtcaagtcgcacagttca
actggcggtcaacttggcgtttaccatcacgcgctccatgttatgaactcgaagctggctacagtggccgagctgctcctcgagcttccaacgcatttcc
acgtatgttcttgttaatcagctctgaagttgtatggtagtctttctcaccctatttgtctatagattgcaatgctctctcagacgcgatgggggtccta
cgtggtcgcaacactaacaatgagccaggagtcagattcaagctggtcaggcgttctggaagtccggtcatctgttgataatgtccgtgagttcgagaag
tggccaagggataccgttcatctctttagtggggaccacgtgcagctctgcaataccgcagctgccccatcgagcaacagacagccatcctcttctattg
atgcttctacaccccaaccagcgtcaacaccattcgatatccccgccccaatacagtctgagaacggattatctgctggaatggcccaagatccgcttac
agccacagcgttcgcaccggatgtgcgagccaccacaagcttccacaaagacatgagcgtccccatcgaccgcgtatcgtccttcgcacgcagtagccag
cagccagagcagacgcgcgcccctgaagttgcgccagctcctgatgaccaatggggcagctttctctagcctggttgaagtcaacttcaactcggtggtc
gtaaaatctacattcacttttcattggttaaaattctgttaaatcactctttcctgcatcagatctacacaagatgcctctcgaccggcagcgtggcgcc
gtattaggcaatgacgacgctgaggaagagcgcgtataccgtccgctactgttccagtcgacgggttatgcatcatcggagctcttccgcgactcgtatg
agatgcattcgcggctgcagacagtgtcgtcgaccgcgcctctattaggggtagagactatttccaccgactcagccgagaatcagaaacaacgacatgt
attcgagccacagattcgacttgaaacactgtcttcaagagctgctacagcggtgctatgggtcacgtacgtggcgttcttattggccatggcgttgcca
tatctacagagcaaaggatatctggaaacggtgcggaagaatgatttttttaatttgaagttgtctgattctgattactgtaggctgtggagttgtcggg
ggcagtttgtggtgacgagcagaggagggaaccgtgcattaaagtggacacgacgaggggcatcgctcagtgggcagcttatgtggccaacgtgtcacgc
tatacagggtcgatcgaaattaagctcgacgtccgggagcaggtgaacacaacgttaacagatttgctgccgtcactggaggagagcaatacatttcagg
agctcgagcgggtagggactgcgtgggatataaaccacgaggtaactggagtgaaaaacagcttatcgagccaatcttcaagtatctccgagcttgagga
tggagagattgatcgggatgctggctatgtgttgacattcgatgccagactctatggcatcgaccacgatgtcacaccagtcgcaaaggatctcgttgtg
gacgaacacaatcagagtatttgggtagagtgccgatcaggaggatcatgtgaagttgtgaggttactggacattacgcaagacgtcgatttactggtaa
gaagtggctgtgtgtatgaatgggttggtttgacaaatttacaatgcgttatcttgcgcagggagggagtgaatatgatgcgtactttgctgtggtgaca
tttaaaggactgtatccgaatgtgtttggtaaagaggtcgtctatcagttcgcgtacacgtacgttgcgtttgatttagctcatttcgcgcatatgctgg
tgaaaaatcttaacctgacttcctacatgatggtgtattctttaggaaacctgccattcacgtgggtgaagttgttgttcgtggtgtatttgtgctcatg
tccattttggcacttccttcctggttcatttcggtgctaaattttcactctggatcatggagtaaagtgttgacggtgcaaaagtggttgctgggagtcg
gcgtcgtgcttttgctgtggcaaaacccagtttacgcagtgtctgagctgtacaccactgtgagcttgcgcactcggtttgtatccatcacgtgccagtc
gttcgctgaggctttcttttacgtgttttggttgagcctgatggatcaacacagtggagatttttcctctcgaagatgttcatttggtgtgaagttcatt
tttgggctggtactttttgcagtggacaccggcatgactgtgttgagaatgccgaagctattttttggagtggaggggatatcaagtgctcatgattttc
accatgaagaaatttatgcacttctcgggtttattcgtacgggcttggtgctgttctggctcgtgtggctaatgacagttggagctcgatcgggtcgaca
tctcaaagcgttgccgtatatggctacccgcttcaaacaactgtcgtatcgcttcctcgtactggaaacgcttctcattttcgtttacgtattcttactc
tcagctctccagatattttatctcacccgaacgtggtacttcgtcggctacgatgcatttatacaagactcagtgcacacctttgccaagatgcacactg
gtcatccatcattaggcaaattcctgttcctgtcggtgtatgtctacttagtcatgttcgtacacttgcccccattggcgggtgatagtactggattatt
ggcttccacagcttttcatgtagacgaaaagccacgagtggactcttacggcttccttacgccagattccaacttgttttgtgtggaaacggcgggatgg
ctactggagttggcgtatcaagcgtacttcgaccccgcgggatgcccgtcagcatccggatatggtgaactcacacttgaacgatatggctttgagctga
tcacgcatttgcgaagcaatcttactgatactcacgctgtcgtcgcatggagtcaagatgaccaccagcgcttggtcatatcatttagaggcacaacaag
caaggaaaactggaagagcaaccttcgcgcagatcaaaaagtgttgtggataaagtctcgagggctgcggtggagaaaatcttgtttggaaaaagtgaag
gatgtggcagcaaagatccccctgcttaatatggcgctgccgcgggttcaccgaggtatgtcacgcttcctgtcttgttttgtgtaattctaatttgctg
gttaatttgcaggattttggattgcgtacgagtcgatccgcgatgaactaaaagaagtgacccgcctcattctggatgaaaatcctggtgtgtcggtgta
tgtcaccgggcacagcatgggaggcgcactagcaatcatagctgcgtatgaccttgcagtaaatttcagcatcaaagtcaacatgtacaatttcggtggc
cctcgtgtcggcaacccaagcttccgccaacactatgacagctgtgttcctacaagctaccgagttgtcatggacggagacatcgtaccagggtggccga
aatttgtacgcattcatgaattgccgttgaatcccggagaggattcactaactcttgctgattgtgtttttgattctagtggggactataccagcacgta
gggaccgagatttccctcgatgtcgcaggtaatgtgattgttgatccaagtttcgttgagcgacatctccataactcttcgagacgcaagacaacgatgc
atggcacaaacgtatatcgaatgtcaattgccaaatgcctcgaaaatctaacaacttcgtaaccagtaatgtacccggaactcccgactcggaagcgtcg
caatccgtttcatttcattgttgtgatagttcgacgcagctcaagcattgaagtactatggatgaagacgatcagcaggctcaggaaggggtaattcgct
cgcatattgaccttgcggaggcagcggccaatggttcccgtgctatggcaagtcaactcattatctgcactacaaagcaatgctttaacgggtgtttgca
cttccaggttgagtttctgctggataacggcgtacacattgatactcccggaaaaggtaacaagaatttcagatagaaaaacatatttgtggtaggttca
tctattgtgtgtgaatcacttgctactgtagatggaacgacgccgctctgtgccgcagcgctatggggaaatgatgccatggtcgcatacttgctggata
aaggagccgatgtgtcggctagaaatgagggtgaggcagcattttaccacgttctaatccaactagcctaacaacgactaattcttcaggcacggggtgg
acagcactacatgcagcttcattccaagagcatgggaaagttgtgcgtgtcttgttggcccaccaagcagaccctaaaatggtcgacgtggaaggacgaa
gagctgtcgactacgccagcatttcggaggcgatttggcccttcttctcaggtcagttaaagcgacagccccttgcgtctaccaacccattaacactaca
ccatgtttgctccgattcaatagcacaaggctggactaaaagcctcaagtcggatctcatttcgaaaggaatcattcgcaagatcccagaacgaccagag
cagacgaacgataaacatgacagcgtacgtccaacaacgcagtaatgaggctgaattaagtctgacccttttgctttgacagatttcgtccttctcacgt
cctgggtcggcctacacgaaagcacagctgtatccgccactcggccgccgaactccagtcattaaggtgcgctaccccaacttcacctcgctatttgtaa
aactaacatcaccacctgcttccagtctcgcggtggccgcatcttgactggtcctattgatccattgggcgacatgcctgtcgagcctgagtccaaccag
cgaggtccgtccctcaagcgtatgggcatctaggaactgccattgttgaagttgcctgaatctaggcactgccattgttgaagttgcctgaagtaacaga
ttcttttcgaccaatgaaaaacaatcaacatcagtaattattatgtattccgtttggtaggtgtgctatagaaaagtagctcttgcgccgatggccgctc
gtttgagagcccccctccgctcagttcttgtatcgcttcgccgccagcacgtcgttctacaatggtgagaggctgcaccgccggaagcgccacacagtat
atatggtagacagttcaagctaacgttcatgatactcctctatgtaccgttcgtagtcgcttcttaacaagggatcgcgtgttatgacccagtcactccg
tgctggtgcccgcaacatgtcgagcgccaccgagcaggaggccaaggagcagatgcaccgatggaccacaatctcgaagggcatgatcggcctgacgtcg
gtgttcacggtgtacgctatcagcgaccacctgagccacgagcaccacgacgaggagaagccggcctacccgtacctcaagatgcgcaccaagcctttcc
cgtggccggagtcggactgcgacctcctggactcggagtgccgtcgcaaggctcgcgaggctaagaaggctctggagtaagcagcacgatatcagtctca
aggtggacacagagcagacttttagatcagacgcaggagaaaggggtcggttgtttgccaaccttcgttttgctcttctgtctgctctcgtcgttttaat
tctcccgctggtgtcatttcctgttcgctcggaacttaatacttcgaagtactccgaaactgaaaaaaaagaaaataaaaaacacgaaacggagtcgtcg
tttgatattaactcgatgtgaattgctgaaagtgttacatggaatttcaatagcacgtgcagtgctggtggtgctggaatgttcgccagcactgcctgta
aattaaagttcgtccagcattttaaaccgcgaagtaacagtatgaagatgtacataacgctacttttcaaataatcattaagtaacaacatacaaaatgg
cagactccatcgcaaagcgtagcgccgaccagcgccaagctcaaccaggcgagcccacctgcacggtcagccatatacaaacccacttgctctatataga
taatgaccctgatattccgccaggtgtgcggccgatatggcgaatttgtatgcgacgccactgatgaagacgtctgcagtcttgagtgccgagacatctg
catatccagacaacaacaaagagttcaatcgaaccagcaactagatgaacgagctgacgaattacgacgcaagttaggtatccaaatcgcagttaaagca
acctctgagaccgcagccaggagctttccagcaaatcgatggcccgttccgatcctggagtttgatcaggatcaagacggcgtggaattgcccaaagaat
tgctggataatcttaatgccaacggttttgagagaccaacggcagtgcagatgcagttgatcccgtgcgtactaaagggacaaaatgtacgtgaactgtt
actattaactgattaacataaagaaactgactttttatctgtaagttgctggtgagtgcacctacaggatcaggaaagacggcttcgtatttaattccag
cgatcactcagtcgttgcttgcacgggagcagaaggaggagattctgacgctcgtgttggctcctgttcgagagctagcgattcagattgaggcagtggc
aaagacgatgatgaaaggaattgcggatatgaagacagcgttgttggttggaggattccccgttcctacacaacgctaccgccttcaaaatggagtgcag
atgattgtggctacaccaggtcgctttcttgatatatttacgaattacagcggtggagatgccattctgccgggtattcgtacctgtgtggttgacgaag
tagacactatgctagacattggttttcggccgcaaatctctcaaattgtggctttgctgggtggggaacgcaacagaaacgtccagttggttttcttgag
tgctactgtgccaaacgaggtcgaaacactggtgcttcagctgttgaaagcccggagtgagcaaacgtatattcgtcttgatgtggtgggtgatacaaat
acaacaacagagagctttatgcttaatccaagcgtgaggcatcaagttcggtggtcagaagacaaagcaaagaagaacgagttgttcaagttcttaaagg
gaaaaggtgaagaatcaacggtaggtcgatcttttaacactgtaatttctatcgatctaactcagttgctgcagcttgtctttgtgggatctaaagttgg
tgcaacgatgctggcacaagcaattgagaagcgttgtgggatcggcgcagcagcaattcacgcggataaaacccagcaagagcgactgcgtttgttggaa
tcgtttgtcaatctagaaatcccgattcttgtgtccacgaacgtgttgagccgtggtatggatctgctgaacgtagaaaacgtggtggtctatgatttcc
caaagaaggttacggactacgttcatctcattggtcgtgtcggacgaggtgccgacgtgtttgggaatgctcttacccttgtgaatgtgggagatcgagc
acttttccgagacctagtgccattgttgcgccaagcaaaagtgtcagtaccgcgtgaagtacaccagcatatcctctcacaggacgccaaaacgtgtatc
cgctccaacgaaacagtagtagatgaaagcacgcgggcttttcgatttcgggatgatctggtggcagttaggaacttgcaaacatcggactggaaggaat
gggagcgcaataacaaacggagacggacccggtcgtaactcggttacaaggttacaagttcttgggtgttacggtatcaagcgtcaatgcagacgatgtg
ggcccactttttcttctacgcactgcaggggtaactcaatctcgttatttatccttctttgcggcagtttgcgagtattgtcgttttcttttcacaaggt
ggttattgtagcacacagcacctcgaataatggcgacctccgtctttgagaccattgcgaagcgccaaatgagtcgagggcaccacaatgcaagcgtcac
gacccgactgaagtaaaatggcatgactcgaacgactactggatggttccaataaccccttcaaatatgacggtatcctgcagagtttcatccccgacga
aacgatgcgactcataattatgccgtgggctagaagcattagagcgaccacgggggctgcaaattggacccggaagcgcaatttattttttataacggga
gtcaagtgaagcgaccagcctcccaagtggccaccattatacaacgagatgtctctcatccgctcaaaacgcaaacactcagattggctgccgtaattgg
aaagcgtaaaataaaaagtcgaacgacgcgacaagaagcttgagaagctggtacagataaagagtgacaaataccaatacgaagatcaaagtccacagaa
atgtactccaagctttaaagatcaggacagtcccactcaagctgactagaaaaattgagcacgagaggaggaatcccacagcgccagaagataccaggct
gaataaacgccgctggggatctgtagagggaaaactgcgtggctggcattaaacacgtgcggagacttgacaaagcgcattttttggatgatcactttct
tcctgtttgcgccaactccacgacggcgaacatttcctcgggagatgtgagttttggtggagtttgcgtgttgaattgacaccagttgcaatgggcatcg
gtacattacacaatggacagctaatccctggttcttctgcaacacttttcttttcctcactgcaatttttgtcatggaaagtgtgagcgtcaacaaccca
ttacccattatatcaacaccagagagatggaaactgcgattctcgttctcgtaatccaagagcgaaaagctggtgcatgacccaacatgatccacacaaa
catgaagagcaccggcggaattccaacgatagtcatgagcgcaaattgacgaactcctcacaccgtgtggtgtgagtcacacgtgagcatcgatgtaaac
gatataatggaaccccacccagtcgataaccattcgaagaaaccgcagatctctgaaataggctgagaccatcccagcggtcatacttgtgacgaaggag
aagaaccagaagtcgaatgttcccacgagaagcagcacaacatcataccttaacgtgctgaaagctcccaggcctagtgggatccataggaaaatggcta
ttagcgacaggatttggccatccagtcctgccatcgacactgccacaatagttaaagacgtcttcaacagattgaaaacaacacatcaaaaagtcgtcaa
gataacctaaatgcaatacactaactacattcaattagctacatttacattgggttctctcgacggaacggtaagactcgactacgtcgagaaattgaag
acgccaacatcttcaaatcaactatttgagaaatatgcgagcttctttttctccctctcgcgaaaaaattgtcatagcagactgtgcctcgaagtattga
cacgttatcgctggacgccgaagctagtcgtacaattaaacgcgagcaccaaagcgaaagcgttaacgatcggctgacgtagaatgggattaatcgaatc
cccacgtgttgattccagacagtccactcgagaatgaccgtgtcacgaagtccggtatcatccacgagaaaaatccgatacattattcgaagatggtcga
ttagcagaaggcataacacaggagcagcatatcgaacacgaaatttcaacatccttcgtgccgttggagtcaatgcatcgagcgtaaaaacccactgagc
ccatagccaccacgataaaaatgtaagacagcgcgagatgttccaattgtacaggatacaaacgccgatatctgcacatgtgatttgaaacgagtagaag
gcgaagtcgaaggacgtgaacaggagcttgagtagttgacgttgatacagagctgtaaagagacctatgaacgcagcggtacacagtaacccagtgacac
atactgggcacatgagttcttcctgaccttccaattcgtgaaaaagagagagatgcgaaaggattaaccctcccaagccaaccgaatagacgatcgaaag
aaaccaagtcggaaaacacgtctcctttacaatgttgcatggcaggagtgtattggtagcgtcaaaagtctgcgagaacttgacaaacatcaagtgctga
atcacgtctgcacctcgcagtgaattttctttcgaatgacatcttgaatcctcacttgccaacgcgagcgaaagtgacggcccagctaccgactccagtt
tcagccgacatcgataaatgacacactgaacgatcgctgatggtttattcctcactcgaagatctttccgtcgtcggaaaacaaccttggcgactaggaa
gctcagtgacaccattccgtttccaatgacgtcgataccggagagcttgtaacttctgtccatattctcgtacgtcacaatagtaaatgtcgacccaccg
tcaacttgacgtaacaagatccacgtgagcactacagaagcagagagtatcgttacaaccaggaaatacgttaaacttcggagtcctaaaacatgcgcat
caaccaaaacgacgtggtgatatccaatccaatcgatgagcattcgaaccgaccgtaaatcgccaaagtacattgacatcgtgacagtgatagttgtcgt
aatagcagagaagaaccaaaagtcgaaagttcggaaaaccagacgcgcgatatcgtatctcagtgtggtaatactgcccaacccgattgggatccataag
agagcggctaatgtcgcaattattcgaccaagtcgtacgtctaccagtggaacgaagacatttaaacaatacgagatcacagcacaaatcagaacttctc
ggtaatacttgtagtatttgcgacggataaacgtgtggactctcccaggtagaagccgatctcgaaaagatttggacagatccactacaggaagaggttg
agcaggtaccagtgcgtagac