Description :
From Genome Similarity Track
Location :
Scaffold_171:38224- 39542
Transcript NameFunction/comments
Physo_144181extracellular endo-1,5-alpha-L-arabinase, putative

Sequence
1318 bases(100 bases per row)
GGATACGTCGAGTTCCGGGTGACGGGAGTTCGTCAGTTGAAGGCAATAGCAAGGAGGGACAAGATGAGTCCACAAATGGTTGAACAAGGCAAGTTGATGG
AGGACTGTATCGACAGTTTTCTATTAATCCTTGAACAACCAGGACGAGTACGGGTAAGCAGCATGCAGCTACCAAGAGAATCGCCATTAGTGGTGATGAT
GAAATCTTTAGTAGTCCAAATAAAATCTCTTCTACACAACAGAGAATACTAGCATTTTACAGTTCTTCGCATTGTTTACCAGTTGTCGACTGCTGTGATC
TGCCCTCGAATCCACATGGTTGTTGAGCAAATCTAGTGCAGCCGCCAGCCGTAACTGCAGATTCATCTGGCAATTACCTGGCCAACGATACTCGGAATAG
TCACGGCATACAAGGAAACAACTCGCAGGCAATGGTAGACGTTGCGGCTCTCGGCTCACGCACTGGCACTTTCAAATTCGACCGCAACAGCGTCCAACGC
AAGTCAAATTTGAACAATGAAGCTCCTTTCGATTCTCGTCGGTCTTCCCCTCCTCGTCGCTGGCGTCGTCAACGGATACGCCAACCCGCAGACGTGCACG
GGAGTTTGCACCAACGCCCACGACCCGTCCATTATCCGCCGCGACGACGGCACGTACTTCCGCTTCTCGACGGGCAGCAAGATCGCCATCCACTCTGCGC
CAGCGCTGACAGGTCCATGGACGTACCGCGGTGCTGCTGTGCCGAACGGCTCGAAGATTAACCTGAAGGGCAAGGACGATCTCTGGGTAGGTGCCGTGCA
AAAGCATATCGTATAGATGTTAGTGGTGCTAACGCTTTCATGTTGTTATTCCCAATTAGGCCCCTGAGGTGAACAAAGTCGGCGACACGTATTACCTGTA
CTACTCGGTCAGCTCCTTTGGCACTCAGAGCTCCGCCATCGGTCTGACGCGGTCGAAGACCATGGAGCCTGGCTCGTGGGTCGATGCGGGCAGCGTGGGC
GTCACGAGCAATGCGTCCAAGAAGTACAACGCCATCGACCCGAACCTGATCCAGGTCGGCAGCCAGTACTACCTTAACTTCGGCAGCTACTGGCAGGGTC
TTCACCAGGTGAAGATGTCCACGGTCCCCGCGAAGAGTACGGGCGCCTCAGCAAACCAGATCGCCTTCACTTCCAACTACGAAGTGGTCGAGGCGGCGTT
CGAGTTCGCGTACAACGGCTACTACTACCTCTTCTTCTCCAAGGGCTCGTGCTGTGGATATGACAAAACTCGCCCCGCCAAGGGCAAGGAATACCGCATC
CTCGTGTGCCGCTCCAAG