Description :
From Genome Similarity Track
Location :
Scaffold_440:3821- 6666
Sequence
2845 bases(100 bases per row)
AGTCGAACTCTTCTTCGCTTCTGGAAGAAGCCGTTCTCGAAGACACAAAAGCGGCACTCAGTGCACGTAGTGGATCATCGATACTGAATAATCCTCATGG
TCCCTTTTATCCTTTGGTCAAGAAATTTCTAGATGTTGAGTGTCACGACCCACCGTCTGTTTTACCTCCCGATAGGGGTGTCCGTCATGAAATTAACTTG
GTTCCTAGGACCAAGTACTGCATTACACGACAGTGACAATTGCCAAAGGAACAACGTGACATCATTGATGACTCCTTTCGTGCCAAGCATGAGGCAGGAA
TGGTACGTGAGAATAAATCTGCACATTCGGCACCGACATTTGTGTCAAAAAGCTGAACGGCAAGTGGCACATTGTTCATGCTTACAACAAGCTTAATGCG
ACCACCATACCGGCACAAACACCAATTCCTAGAAAAAATGTTCTTTAGTAGAACATAGTTGATTGTATTATGTATTGTGCACTCGACTTAGTCTATGGAT
ATTAACAATTGCTCATGCGAGCGAGTGATTTTCCGCTGACGGCCGTGAGCACTCCAAGTAGTATGCTATGGGAATGGTTGGCGCTGCCATAAGGGCTATC
TAACATGACGGCTACATTTAATCGTCGAGTGACGTAACTTTTTCGTCCCCATCGGGATTAAGCACAGACGTACTTTGATGACTTTTTTGTCCATAGTCGT
GCCGAACAAGGTCGGTCAGATGTTGAAAATCACATTGGTCATTTGCAAGCCTTGCTTGAGTGCATGCGCACTAATACATTGTGCGCCAACGCGTCTAAAT
GCACTTTTGGTGCAGAGGAAATTCCCTATCTAGGATGTTTCATTGGTATGCGCGGCCTTCGAGCAGATCCCGCTAAGGTCAAGGCTATAGTGGACCGGCC
GATTCTTAAGAATCAAAAGGATTTTCGTAAGTGGCTTGGCCTCACAATTGTTTACACAAATACAGTGAAAATTACGCTGATATGGCTCGGCCATTAACCG
ATCTCCTTAAAAAGTACACAGATTGACGCTGGGACAACACCCATGCTGACGCATTTTAGGCACTAAGGAGAGTCTCCTCCATGTTTTTAATTTGGCGTTG
CCAAACCCTGAGTACCATTTTAGTGTTGTCTGCGATGCATCCCACTTTTCCATAGGCAGTGCTATGTTACAAACAGACTCTGCAGGCCACGAGGGAAATA
TAGCATTTGAATCTCGTCAGCTGAAAGCTGCTATAAGGAACTATCCAGTTCATGACAAAGAGCTACTTGCTATGAAGTATGCACTTTTCTAGCTTAGAGT
TCATCTGCTCGGCTCCAAGCCATTCGTCGTCTACACGGATCATGCGTCATTACGTACGGCGACACATTCGCCTCACCTCTCTCAGAGAAGGGCTCGTTGG
CTTTCGTTCTTTGCAGAATAGAACTTCGAGGTGAAGTAGAAACTGGGGGGAAAAGTTTGTTGGCAGATGCCCTATCTCGTCGTCCCGACTATGAGCTTGC
TCATGTCACGAACTTGTCGTCTCCTATTGAGTAGTTAATTCGTGTGACACATCCACGGAATTCTCAATGGGTGGCATTATTTTATGCCCTTGGGAGTACA
AAGACTCGGAAATTTATTAATCGACACAGTTCCGTGCCAGCTTACATCGACATTTCATAGATAATGGTCTCTTGTTCTATCGCACCGATGTAGCGGAAAC
TGCTCTCATTGTTGTACCTCACGATGAGGATTTGAAGTATCAAATCCTCTTTGAGGCCCATGACACTGCTCTCGGTGGGCATATGGATCGTGAAAAGACT
TACGGATTTGTGAGTCAACACTTCTGGTGGCCTAAACTCTACAAATGGGTGAGCACATACGTGTATAACTGCAAAACGTGCCCGAGGGTCAAACCCTCAG
CACACTCGGGTGCGCCACTCGCCAGATTACCTGTGCCCACGGGGTGTTGGAAGTCCATCAGTATGGATTTTGTGTTTGGTCTTCCCAGAGACTGTGACGG
CAATACGGGTATTGTGGTCTTTGTAGACCGTTTAAGCAAGATGGATCACTTGGCGGCGGTGCTGGATTCCGTCGATGGCAAAGGTACAGCTATGCTGTTT
ATCCATCGTGTGTTTTGTCAACACAGGTTGCCGCTAGCAATCATCTCTGATCGCGACCCTCGCTTCACAGGCAAGTTTTGAACTTCCGTCTTCAAGGTGC
TTGACACGCGATTGGACATGTCCACAGCGGATCATTCGCAGACCGATGGTCAAACTGAGAGGTCAATCACGTCATCGGAGATGTTCTTCGCAGTGTTTGT
GGTGAGTTGCCAAAGACTTGGAGCTTGATGCTCCCTGTCTTCGAATTTGGTTAAACTACGCTGTACATGCCTCGACCAGCTTTGCTCCCTTTAATGCGAA
TAGCCTCACGTACCCGCGCGTTCCGCTCACGATACCACTGCGGTTTTCGAGCTTGGCGAGGGAGCGTTTGCTGACAAATTTGCTGATATCAGCTTTAACA
CTATGCAGAAACAAATGGGCGAGTTTCTCAAGACGTGCTTTATTGTATTAAGACATGTGCGTGATGTAATGGCTGATAACCAAGATTAACAAGAATAACA
AGCTGATGCTAAGGGCAGAGGATGTATTGATTCTTATAAAGTTGAAGACCAAGTCTTATTAAATGCTCAAAAACTACCTACAAATGTAGTGTGTGCCGCC
TTCAAGACAAAATTGCGTCGCGGCTTTATTAAGCCATTCACAGTCGTCGCTAAAAAAAGGCCTTGCATATGACCTCAATCTTCCGCTTAAGCTGCGCACA
CACCCATTGTTTTACGTTGCCTTGCGTAAGCCATATCATGATCCT