Description :
From Genome Similarity Track
Location :
Scaffold_49:38208- 40075
Sequence
1867 bases(100 bases per row)
CAGTGGTATGCTTGCCACCCGAATTTCCTATTGTAAAAATAGTGTTGGTAGCAATGTGACAAACCACATTTCATAAGTAGATCCATGAGATTGAGTCACC
AAGGCTTGAACACTTCGGATAACCTTCCCTCAATACTCAAGGAGTAACCCGGTCGGATGATAACTTCGTCGCCAGAGTCTTGCTCGATCACTATCTTTGA
CAATCTGAGCAGCGGGATGATAACATCACCAGGTAAGTTCATTGTCGTACTGTAAAGATCCAATCGAATCCCGGATGGGATCATGAAGTCAGTCTTTCGA
CTGAGGGCTATGCTTGCATGATGGGGCATAATCTACATTCCTAACTTGTAGACTACTTCCATCCGGGACCTTGGCTGTGACTCGGGACGTCGTAATCAAT
TTAGACTTGCCGATACCTTGAACATCAATCTGTATACGTTAGATCGTTCGGATCTTTAATTTAGTCTACCCGGAAACGACTCGCTGATCGCTGAGATGTT
AGATCCGTTGTCGAGTCGTATCTTCGTCCATTCGCCACTCATTACTACCATGACTAGAGCTCTCGTTCTCTGCCGTCAATCTTCTTCGGTGACTACCTCC
CTCGTCATTACCAGGTAATAATTTAGCCGTTTGGCCGTCACAATCCACGCCTGCGTGTTGAGTGCTTCCATTCTAATAATAGACCTGTGCTTTCAATCCT
CATCATCCATCTCTTGCTCTGGTCTGAGCTGACCGGATTTTTTGTCGTTCATTGGCCTTTAGTCGGAACATTCTTTTTCCAACAAAAGCGAATACATACT
TCGCTTCCACCGCTGGCTTCACTGACTGTGGCATATTGCTGTCATCCAACCCAGTAAGAGTCGGCAAGCCTGTTAGTTTATCTTGACCCCAGTAATATAT
GTCTAGAAAATCTTTGGATATGACTAATTTGTCGATTGATTACTGGACAAACTAGGAGAGCTTCCAAAATTACGCAATCAAAATACATCGACCCACGTCA
TGCACTTGTTTGCATAATTTACAATGACACCCGCAAAAGCTGGCGTTGTGCCCTGCTCCTTCGCAATGCCACCATACCCGTCGTTACTCAAATCCGTCCT
GTCGGTCGCGTGACTTACACGTTTGATGTGATCTGATCGGGCCGTTCAAGTCTCGACTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN