Description :
From Genome Similarity Track
Location :
scaffold_22:38207- 39267
Sequence
1060 bases(100 bases per row)
GAAGACACGGAAGGTAAGGTTTGATGAGCAATCGTGATACGCTCTAAGGAAACCCAAGGAAACCCCGATATTTGTCCTGACAAGGTGCTGGACAAATTGC
CTCTGACAGAGGcattcgtcatgagattgttATACGGagtattgtatcacacggcagtAGCCGTTGCCAAAAGAACAAGTCATTGCAATTGACAAATTTC
TTGGCGCAGCGACAAAAGGCTGGCAATGTGCGTGAAAGAAAATCTCCGCATTGTAGTTTAACCATAGGTGTGAATAAAGCCAAGGGTGGTAAGCGCATTA
TCCGCGCTTCCAACGAATTAAACGATGCGGACATACCTGCCCAGAATCCGGTTCCACGAAGGTTATAACACTTGAtgagatttttttgtcaGTACTATTT
TCGGTGCGATCGATCTAAAAGATGATTTCTATCAGATACGACTGCGCGAAGATGATACACCACTGGATGCAGTCAGTACCTCCACAATAAGTTTTACGCT
AATCTGAAAAGTGAATTTTCTTTGCACCAGAAGTCTTCGTTCGCGGCAGCTTTGTGGGCAAAAATGGCGTTCGTGTAGTCCGGAGAAAGTCGAAGCTATC
AGTTATTGACCTGTTCCAGTGGTTGGCTTGaccaactatttgcacaaatacaccCGCAATTATGCAGCGTAGGTGGAACCCCTAACGACTCTTTTGAGAA
AGAACGATGAGTGGGAATGGTCAATCGTTCACCAGGCGGTATTCGCCCCACAAGGCggtatttgccgaagtgaagaagagcttgAGAGAAGCTCCTGCTC
CTGCCATTGCAACGCATCACAAGTCTTTTCATGTGGGCTGCGATGCAAATGATAATGCCATCGGTTGTGCGCtgatgcaacacgatggTTAGGGTTGAGA
GCAAATGGTTTTTGATCAGTTGCGACAACTCCGGCCCGCGGAACGGAACTATTCAGTTTATGACACAGAGTTTTCTAGCAATGAATTATGCTTCGGTTAA
GTTCCATGTGTACTTGCTTGAAAGGAGCGCTTTGCagtctatacagatcatgcctcaCTG